SimpleSearch - Line and FST details


Line specific information

 
Line ID 130F03
Vector Used pAC161
Line Availability only available from NASC (N412447)
Segregation Analysis 50:32:30
Confirmed for Hit At2g27900
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g27900

 
Sequence (A. th genome BLAST matches underlined)
>22-K012667-022-130-F03-8409
TTGATCCATGGTAGATTTCCCGNGACATGAAGCCTTTACAATTGAATATATCCCGTAAGT
TGTGTATGCTTTGCTGAGGCGTATGAGATATCATTACTAAGCCCACAGGTGACATTTTGG
TTTTGTTGTTGTGTATGATTTTGATCCGGTAAGGCATATTTTGGAGAATGTGCCGGATGA
TGAAAGTGAGTGAACTTATTTAGAGAAGCACGGTACTAACTTTTAACTTCTCTGAAGGAA
TTGAATATAAACTGATGCGTCTATTGTGAAAGGTTAAGAATGTTGATGAACGTTTTACTG
AGAGACTTTAATAAGTTGTGTTTACTGAGTAGGCTACCTTGAGGTTGGAACAGCCGGATA
ATGTGGCACAAACTCTGCCTCACCATGATATGGAGCATCATGATGTAATGGGTAAGTATT
CTTGAATTGTGACATAAATATGCCGTGAGGCTTTGTGAGTATTACATTAAGCTTTCGGCC
ATGGATAGGGATGAATTTGGACACACACTAGGAGAAAGATCTGAAGATCGCGGACGTCAT
CGGCAAGGTATGAGCGACCTATTCTTAACCTATAGGGTACATACACTATACAGAGGGGTT
AATTTTCTATTTTATCTATTACTGGGTCGACCTTGGTTTGGGCTGTTTTTGGGGGTTAGT
GGCAGAATGGAAAACCACATTTCGGCCTCCTTTTGGGATGAGGGCTCCAAAAAAACTTTA
TGGACCCCCCGTATTTCAAAAAGAAGCAGCCCTTTCTGGGGGGGCGTGTCATTGATTTGC
AACTTTGATGGGGACCCCGCCTTAGGGGGGCGGGCGCGCCGGGGGCGGGTCTAGGGGAGC
CTTCAGCGCCCTCTGGAAACACACACGATCCAGCACGAGCACCTGTGGGCCCGGAGGCCC
GCGGCGGCGCCGCGCTAAGCAAACCCGG
GenBank Accession AL764753 [GenBank]
Graphic View Graphic view of gene At2g27900
Predicted Position of Insertion Chr2:11878171 - go to primer design
BLAST e Value 2e-151
Hit Clone Code (BAC ID) F15K20
Hit Gene Code At2g27900 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation coiled-coil protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40