Sequences from confirmation amplicon


Confirmation sequences for line 130G11 and hit At2g13680 are shown.
Line ID 130G11
Locus At2g13680 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:5697673
Primers used for PCR VL40 - 3144, show primer details
   
Sequence Name 09-K024137-022-130-G11C-VL40
GenBank Accession LN490005 [GenBank]
Sequencing primer gene specific primer, VL40: 5'-AATACTGATTAGATCAATGGGGGA-3'
Sequence (A. th genome BLAST matches underlined)
>09-K024137-022-130-G11C-VL40
AGCAAATGAAAACTACAAGAGACTACCTGTGTCGTATCACGGGTTGATTTGAAAAGATCC
CCATCATCACGCATTGGCCAGCCAAGAGAGAAGCAATCAGGAGTCCTATATAACAGTAAT
GCGCAAATGATATAATAAACTCAGGTGTCCTCACCAAGTAAAGGTGCAATCTACAGACTT
AAGTTCAAAATACCAGAAATATTCGTTCAGATCATCATAGTTGGACCAATCTGAGTGAGC
AGCCTTGCCATTTGCATTCTTGTTTGCTTCCTAGTTCATAAAAAAGGTTAGCTATGATGT
ATACAAGATCATGATTCTTAAAATGCCATCGACCTATCAGTCAAACTTGTACCGTTTGAA
CTACACGGTAGATTGGTGTAATGACCTTCCTTAAAAATGCCTCATCATCTCCACCGGTGA
TGGTCATTTAAACTATCATCAAACACTGATAGTTTAAACCGAAGGCGGGAAACGACAATC
TGATCCCCGGGTACCCTGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGT
CTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATATCACATCAAT
CCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCT
Primers used for PCR FL12 - 8474, show primer details
   
Sequence Name 49-K028352-022-130-G11C-8409
GenBank Accession LN506719 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>49-K028352-022-130-G11C-8409
CATATTGGTAACGATGCTGACATTTCCAGCCAAGAGACCATGGTAGTTCATAAGCCATCT
GTGCATAATCAAGAGATCAAATTTGATATACTTTTACTGACCCATGACATCAGCCTCAAA
AAGGTAAACATGTCTGAATGTGTTACTGACATTGTGGAAAATATAGCACAAGCATTCTGG
CATGAAGCGAATATTTGCAGCTTCTCCCCAGATGAGAAGATACAAGCCCATATATAGTAT
CTTCCGCTGTTGTATATCTTGAGCAGCTTGAGGAAGCCTTTGCAAAAAAATAGAGTGAAT
TTTGAGTACAGTATGAATATCATTCAACAACATTTTCCATCCAAGCGACTTAGAAAATAA
AATTTTGTCAGCTACCTTAAACTGTGTTTACGTCCTAAAAATTTGCACCAATTCTTGTAG
TTCTTAAAGAGCTTTGACATGACAGTATCAACGGCTCTGTCATCGAGCTGCATATATAGA
ATAAATAGATCAAGAATCTGTTGC
   
Sequence Name 49-K028352-022-130-G11C-FL12
GenBank Accession LN506720 [GenBank]
Sequencing primer gene specific primer, FL12: 5'-AAAAACGTTTCCTTTAGCAACAGA-3'
Sequence (A. th genome BLAST matches underlined)
>49-K028352-022-130-G11C-FL12
TAGGAACGTAAACACAGTTTTAAGGTAGCTGAACAAAATTTTATTTTCTAAGTCGCTCGG
ATCGGAAAATCGTTGTTCGAATGATATTCATACTGTACTCAAAATTCACTCTATTTTTTT
GCAAAGGCTTCCTCAAGCTGCTCAAGATATACAACAGCGGAAGATACTATATATGGGCTT
GTATCTTCTCATCTGGGGAGAAGCTGCAAATATTCGCTTCATGCCAGAATGCTTGTGCTA
TATTTTCCACAATGTCAGTAACACATTCAGACATGTTTACCTTTTTGAGGCTGATGTCAT
GGGTCAGTAAAAGTATATCAAATTTGATCTCTTGATTATGCACAGATGGCTTATGAACTC
CATGGTCTCTTGGCTGGAAATGTCAGCATCGTTACCAATATGGATCAGCAATGAGTATGA
TGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGA
AAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTA
TTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGC
GAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTA

Last Updated on 07.07.2016 14:16