SimpleSearch - Line and FST details


Line specific information

 
Line ID 130G11
Vector Used pAC161
Line Availability only available from NASC (N412467)
Segregation Analysis 50:49:42
Confirmed for Hit At2g13680
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g13680

 
Sequence (A. th genome BLAST matches underlined)
>87-K012957-022-130-G11-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTTGATGATAGTTTAAATGACCATCACCGGTGGAGATGATGAGG
CATTTTTAAGGAAGGTCATTACACCAATCTACCGTGTAGTTCAAACGGTACAAGTTTGAC
TGATAGGTCGATGGCATTTTAAGAATCATGATCTTGTATACATCATAGCTAACCTTTTTT
ATGAACTATGGGATCCTCCCTATAGTGAGTCTTTTNACT
GenBank Accession AL764770 [GenBank]
Graphic View Graphic view of gene At2g13680
Predicted Position of Insertion Chr2:5697689 - go to primer design
BLAST e Value 2e-76
Hit Clone Code (BAC ID) T10F5
Hit Gene Code At2g13680 [TAIR] [MIPS] [SIGnAL]
Gene Annotation callose synthase 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g39780

 
Sequence (A. th genome BLAST matches underlined)
>87-K012667-022-130-G11-8409
TTGATCCATGGTAGATTTCCCGGACCATGAAGCCTTTACAATTGAATATATCACGGTTGA
ACTATAATCCACTTTGCATGCATGCATGAACACTACTATAGAGAATCCACCTTATTGTGA
TTAAAAACAACTAAAACTACTACTATGGGATCCTCCCTATAGAGATGCGTATAACTAAAT
CGTCAACAGAACAAAAGCATCTAAACAATGTAATTATTAAATTTAACATTCTACTGAAGA
AATTTATATATAATTTTAAAATGATAATGATCTAAATGGGCGGCTTAACTTATGGTGTTA
TATAAGCAAAGAACTTGGCCTCAAGCGAAACCAAAAGCGACAGAAAAAAACAAATATTTA
GAAACAAAAAATGCTATAATTCTTCCTTTTTCTTGTTCTTTCAGAGATTTTGATTTCTAT
TCAATCGACTAAGAGGGCGTGTTTTTAATCCCTCTCTGTTGTAATTTTGTTTGCTATGGG
ATCCTACCTATAGCGAGACGTTTTACACTCAGCTCTGTCATCGAGCTGCTTATATAGAAT
AAATAGATCAAGAATCTGGTGCTAAAGGAAACGTTTTTAATAGATGAAGATGTATAATGG
AATATTGAGATAATGCTTTGGTTTTCTATCAACATTGGACAATTCTGTTTAAAGGTCTTT
GGAAAAGAACCCCTTGGTATAAAGGACTAAACATTGGGAAATTCTATTATGTTGTACACA
GGGGCGATGAACCGGTAATCAGAACATAACCCAAGCTCTGATTACCCACCCTACTCATCC
CTA
GenBank Accession AL764769 [GenBank]
Graphic View Graphic view of gene At4g39780
Predicted Position of Insertion Chr4:18459466 - go to primer design
BLAST e Value 5e-142
Hit Clone Code (BAC ID) T19P19
Hit Gene Code At4g39780 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 14.10.2014 10:23