Sequences from confirmation amplicon


Confirmation sequences for line 132G06 and hit At5g64940 are shown.
Line ID 132G06
Locus At5g64940 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:25952348
Primers used for PCR LB03 - 8474, show primer details
   
Sequence Name 03-K024450-022-132-G06C-8409
GenBank Accession LN487318 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>03-K024450-022-132-G06C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAAATATACTAATGGT
TACTTTCTTCTGCAGTATTGGATGGCATCGGCAAAGGTCTTGACCCCCGATTTGATATAA
CGGAGATTGCTAAACCGTGAGTCTTAACACACTATATTTTATCTTCTTGTTAATCAGAAG
AGTACTCAAATACTTTTGTTATCCAGCTATGCTTTGGAATTGTTGCGGTTTCGGGAAGCT
GGAGTGGAAGTTGTAGTAAAGGTACTTGCAAGGCTTATCTCTACTATATATATGATCTTA
TCACATAGCTTTATATTCATATTCAATCAAATTAACTATTGTAGGACCTGAGAAAGAGAT
GGGACAGGCAATCACAAGCATTCTACAATCTATTTAGACAAGCGGATAGAGTTGAAAAGC
TAGCTGTAGTCATTGAACGACTTGTAAGAAACTAACACTCTCACCCACCACAAACTCCCA
TTCTACATGAATTTCTTTCTAATGAGTTTACTTTCATCC
   
Sequence Name 04-K024450-022-132-G06C-LB03
GenBank Accession LN487757 [GenBank]
Sequencing primer gene specific primer, LB03: 5'-ATGAAATGCTTTCAAAGAACGACT-3'
Sequence (A. th genome BLAST matches underlined)
>04-K024450-022-132-G06C-LB03
AGATTTTGATGTAAAAAAGACATGAGAATGGAAAGCTCTACTTACACTTCCTACTGTTTT
TTGAACAGCTGCAACGCGTTGAAATGCCCTCTCAGACTCTAGCGCTCGGACCCTAAGCTT
CAAATCACCTTGCTCCTGAGGATGAAAGTAAACTCATTAGAAAGAAATTCATGTAGAATG
GGAGTTTGTGGTGGGTGAGAGTGTTAGTTTCTTACAAGTCGTTCAATGACTACAGCTAGC
TTTTCAACTCTATCCGCTTGTCTAAATAGATTGTAGAATGCTTGTGATTGCCTGTCCCAT
CTCTTTCTCAGGTCCTACAATAGTTAATTTGATTGAATATGAATATAAAGCTATGTGATA
AGATCATATATATAGTAGAGATAAGCCTTGCAAGTACCTTTACTACAACTTCCACTCCAG
CTTCCCGAAACCGCAACAATTCCAAAGCATAGCTGGATAACAAAAGTATTTGAGTACTCT
TCTGATTAACAAGAAGATAAAATATAGTGTGTTAAGACTCACGGTTTAGCAATCTCCGTT
ATATCAAATCGGGGGTCAAGACCTTTGCCGATGCCATCCAATACTGCAGAAGAAAGTAAC
CATTAGTATATTTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACAT
GGATCAGCAATGAGTA

Last Updated on 23.10.2014 13:25