SimpleSearch - Line and FST details


Line specific information

 
Line ID 132G06
Vector Used pAC161
Line Availability only available from NASC (N412654)
Segregation Analysis 50:45:35
Confirmed for Hit At5g64940
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g64940

 
Sequence (A. th genome BLAST matches underlined)
>47-K012720-022-132-G06-8409
AATTTGATCCATGTAGATCTTCCTTGGACATGAAGCCTTTACACTTGAATATATCCTGAG
ATATTCTTATGGCTACTTTCTTCTGCAGTATTGGATGGCATCGGCGCAGGTCTTGACCCC
CGATTTGATATAACGGAGATAGCTAAACCGTGAGTCGTAACACACTATATTGTATCTTCT
TGTTAATCAGAGGAGTACTCAAATACTTTTGTTATGCAGCTATGCTTTGGAATTGCTGCG
GTTTCGGGAAGCTGGAGTGGAAGTTGTAGTTGAGGTACATTGCAAGGCTTATCTCTACTA
TAAATATGAGCTTAGCACATAGCTATATATTCATATTCAATCATACTAACTATTGTACCG
ACCTGAGAAAGAGATGGGACAGGCTATCTCAAGCATTCTACAATCTATTTACACAGGCGG
ATAGAGTTGAATAGCTATGGGATCCTCCCTAGATCTTCTCACTGCGCGTCAAATCTCCAG
TTGGCACAAGCACTCCCATAAGAACCATAGCTAGAATGACCTGCCACACGAACGTTAATT
CCTATATATTTGAAGATGAGCTCAGGTCGTATGCAGCATGTCGGTAGAAGACTGAAAGTG
ACAAGCACCTAGAGACTATACCTTATCTGGATCCTGTTCATAGACGCCATATAATGCTCT
CCAGCAACCCTCGTCTATAATTGGGCTAATACTGCAAGTGTAAAACACGTTGTCCAGAAA
CATAAATTTTAACAGTTGATTAAAGGAGGATCACATTCTTTACCCATATTGAACCGAAAG
CGTTTTTCAACTACTAACAGAGTCATGTTGGACCATAATAAAAAGTAGTACCCTTCCATC
TTTCCCAGGGCGTAAAAAATCAACCGCCCGCCTTGAATTATTAACTGGTTTATTTCCAGG
GCCGGCAGAAAAAACTTAACCCAAA
GenBank Accession AL764926 [GenBank]
Graphic View Graphic view of gene At5g64940
Predicted Position of Insertion Chr5:25952348 - go to primer design
BLAST e Value 1e-145
Hit Clone Code (BAC ID) MXK3
Hit Gene Code At5g64940 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ABC2 homolog 13
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23