Sequences from confirmation amplicon


Confirmation sequences for line 133B11 and hit At2g41690 are shown.
Line ID 133B11
Locus At2g41690 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:17382094
Primers used for PCR RE33 - 8474, show primer details
   
Sequence Name 09-K025944-022-133-B11C-8409
GenBank Accession LN490021 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>09-K025944-022-133-B11C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATGAGTATTTTGCTCATTTACGTACG
TATATATGCTTAATTAAAGGCATTAATGAGTGTTGTTACAAAAATATTATAGGGTTTTCG
AAAAGTAACGACGATAAGATGGGAATTTAGTAATGAGATGTTTCGAAAGGGGCAAAGAGA
GCTTATGAGCAATATCCGAAGAAGGAAGAGCCAACATTGGTCACACAACAAGTCTAATCA
CCAGGTTGTACCAACAACAACGATGGTGAATCAAGAAGGTCATCAACGGATTGGGATTGA
TCATCACCATGAGGATCAACAGTCTTCCGCCACTTCATCCTCTTTCGTATACACTGCATT
ACTCGACGAAAACAAATGCTTGAAGAATGAAAACGAGTTATTAAGCTGCGAACTTGGGAA
AACCAAGAAGAAATGCAAGCAGCTTATGGAGTTGGTGGAGAGATACAGAGGAGAAGACGA
AGATGCAACTGATGAAAGTGATGATGAAGAAGATGAAGGGCTTAAGTTGTTCGGAGTAAA
ACTTGAATGAAACTAGATTGCTAGATTGATATTCGTAATATACCAGTTTCTTCATATTCT
TAGAAGTTTTGCATAACTATATATAGTACTCTTTTAAGACATGCAAGATCAGAACATATG
TCC
   
Sequence Name 10-K025944-022-133-B11C-RE33
GenBank Accession LN490494 [GenBank]
Sequencing primer gene specific primer, RE33: 5'-ACAGCAAAGAATCCGATATTTCTC-3'
Sequence (A. th genome BLAST matches underlined)
>10-K025944-022-133-B11C-RE33
ATATGTTCTGATCTTGCATGTCTTAAAAGAGTACTATATATAGTTATGCAAAACTTCTAA
GAATATGAAGAAACTGGTATATTACGAATATCAATCTAGCAATCTAGTTTCATTCAAGTT
TTACTCCGAACAACTTAAGCCCTTCATCTTCTTCATCATCACTTTCATCAGTTGCATCTT
CGTCTTCTCCTCTGTATCTCTCCACCAACTCCATAAGCTGCTTGCATTTCTTCTTGGTTT
TCCCAAGTTCGCAGCTTAATAACTCGTTTTCATTCTTCAAGCATTTGTTTTCGTCGAGTA
ATGCAGTGTATACGAAAGAGGATGAAGTGGCGGAAGACTGTTGATCCTCATGGTGATGAT
CAATCCCAATCCGTTGATGACCTTCTTGATTCACCATCGTTGTTGTTGGTACAACCTGGT
GATTAGACTTGTTGTGTGACCAATGTTGGCTCTTCCTTCTTCGGATATTGCTCATAAGCT
CTCTTTGCCCCTTTCGAAACATCTCATTACTAAATTCCCATCTTATCGTCGTTACTTTTC
GAAAACCCTATAATATTTTTGTAACAACACTCATTAATGCCTTTAATTAAGCATATATAC
GTACGTAAATGAGCAAAATACTCATTCAATTGTAAATGGCTTCATGTCCGGGAAAATCTA
CATGGATCAGC

Last Updated on 07.07.2016 14:16