SimpleSearch - Line and FST details


Line specific information

 
Line ID 133B11
Vector Used pAC161
Line Availability only available from NASC (N412695)
Segregation Analysis 50:23:20
Confirmed for Hit At2g41690
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g41690

 
Sequence (A. th genome BLAST matches underlined)
>82-K012719-022-133-B11-8409
NTTTGATCCATGTAGATCTTCCTGGACATGAAGCCTTTACAATTGAATATATCCTGAGAG
CATGAGAGATCGACATCAGACCTCTAACGACGCGCAGTTATGGAGACGTACCTTATATAT
CGAGACGTCAGGCTTGTTCAGGCGACTGATACATTGGGAGCCTGACTAAAGACGATGACC
ATCACCAAACTGAATCTCACCGGAACCTATGGGATCCTTCCTATAGGGAGTCGTATTACT
CACGCCANGCTTCATCTCCAGGTTGTTCTTACTACAACGATGGTGAATCATGAAGGGCAT
CAGCGGATTGGGATTGATCATCACCATGAGGATCAACAGTCTTCCGCCACTTCATCCTCT
TTTGTATACACTGCATTACTCGACGAANACAAATGCTTGAAGAATGAGAACGAGTTATTA
AGCTGCCAACTTGGGAAAACCAAAAAGATATGCAAGCAGCTTATGGAGT
GenBank Accession AL764963 [GenBank]
Graphic View Graphic view of gene At2g41690
Predicted Position of Insertion Chr2:17382069 - go to primer design
BLAST e Value 7e-86
Hit Clone Code (BAC ID) T32G6
Hit Gene Code At2g41690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation heat shock transcription factor B3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40