Sequences from confirmation amplicon


Confirmation sequences for line 134G09 and hit At1g03150 are shown.
Line ID 134G09
Locus At1g03150 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:757037
Primers used for PCR DL09 - 8474, show primer details
   
Sequence Name 39-K017120-022-134-G09C-DL09
GenBank Accession LN503176 [GenBank]
Sequencing primer gene specific primer, DL09: 5'-CCTGACTATTTTCATGTTGCTGAA-3'
Sequence (A. th genome BLAST matches underlined)
>39-K017120-022-134-G09C-DL09
GTTATAGTAAGTAATCCTCTTGTTCTCTTCGTTTTGATTTCTTTATGTCTTCGTTGGTTT
AGGAATTTGAAATTCGTGGAGATTATGTTTACTTTTAGGGTTGAAACTTAGATGATAAAC
TGTTAGTGTAAAAGCCACTATTGATTTTTTTTGGTTATCAGATGGAGATAGCTTGAATGT
TGTTAAAACCAGGAAGAGTGACTCTGTTTGAAAACTGATTAACACAAACCAGGATGTATA
AGTGTTTAAACAAATTCTGCTTGTATTAGTCCTAGTCTCTGTAGTTAGCGGTTTTAGAAA
TCTTGATA
   
Sequence Name 40-K017120-022-134-G09C-8409
GenBank Accession LN503539 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>40-K017120-022-134-G09C-8409
CATGAAGCCATTTACAATTGAATACAGGTATAGTAATAGGGCACCACGAGAACAGAACGT
CAATAATGAAGCATATATCGTACTTGAAGAAAATAAAGAAAGATAAAGCCTTGTATAAAT
CACATTTCGAACCAATCCAATAAGGTATAGCATCATTATACTACCAACCCTGAAAGACAG
AAAAATTTGAGCCTTGATATAACTCATAACTCATTCTCTGGACATTTAGAAGTTAGCACA
AACAATCTTAAGCCATGCTTCCTATGCATCTTCTACCCCGTATCGAGATTTCTAAAACCG
CTAACTACGGAGTCTAGGACTACTACAAGCAGAATCTGCTTAAACACTTATACATCCT

Last Updated on 07.07.2016 14:16