SimpleSearch - Line and FST details


Line specific information

 
Line ID 134G09
Vector Used pAC161
Line Availability only available from NASC (N412849)
Segregation Analysis 100:65:55
Confirmed for Hit At1g03150
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g03150

 
Sequence (A. th genome BLAST matches underlined)
>71-K012718-022-134-G09-8409
TTGATCCATGTAGAATTTCCCGGACATGAAGACCTTCACAATAGAATACCTGTATATATA
ATAGGGGCACCACGAGAACAGAACGTGAAGTAATGAAGCATATATCGTACTTGAAGAAAA
TAAAGAAAGATAAAGCCTTGTATAAATACATTTCTGAACCAATCCAATAAGGTATAGCAT
CATTATACTACAAACACTGAAAGACAGAAAAATTTGAGCCTTGATATAACTCATAACTCA
TTCTCTGGACATTTAGAAGTTAGCACAAACAATCTTAAGCCATGCTTCCTATGCATCTTC
TACCCCATATGAAGATTTCTAAAACCGCTAACTACAGAGACTATGGGATCCTCCCTATAG
TGAGC
GenBank Accession BX649710 [GenBank]
Graphic View Graphic view of gene At1g03150
Predicted Position of Insertion Chr1:757285 - go to primer design
BLAST e Value 9e-138
Hit Clone Code (BAC ID) F10O3
Hit Gene Code At1g03150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Acyl-CoA N-acyltransferases (NAT) superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03