Sequences from confirmation amplicon


Confirmation sequences for line 134H10 and hit At2g02560 are shown.
Line ID 134H10
Locus At2g02560 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:696170
Primers used for PCR XD01 - 8474, show primer details
   
Sequence Name 43-K020358-022-134-H10C-8409
GenBank Accession LN504688 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>43-K020358-022-134-H10C-8409
TATGCTTAGAGATGCATTCTGAATTTTATAGGTCAGGACAACGAGCCCAGCTGCTTTTAC
CCGTGCAACTGTTGTTACTGCTGTGAAATATTCAGTAGTGGAACGACCTGAGAAATTAGA
TGAAATCATCTTCCCTCAGATTTCTTCTTTCCTCATGCTAATCAAAGATGGTGACCGTGT
AAGTGAAATTTTTTAACCCCTTTCTCCTGATACAACATAAAACATCAATAGACATTGGAT
AATAATGACACTTTGCTGTGTAATCCTAACTTTTTCCTTCTGTTGTTGCAGCATGTTAGG
CGTGCAGCTGTCTCAGCTCTGAGTACTTTTGCTCATTATAAACCAAACCTTATTAAAGGA
CTTCTCCCTGAGTTGTTACCACTTC
   
Sequence Name 47-K020358-022-134-H10C-XD01
GenBank Accession LN506054 [GenBank]
Sequencing primer gene specific primer, XD01: 5'-AGAAGTGGTAACAACTCAGGGAGA-3'
Sequence (A. th genome BLAST matches underlined)
>47-K020358-022-134-H10C-XD01
GTTTGGTTTATAATGAGCAAAAGTACTCAGAGCTGAGACAGCTGCACGCCTAACATGCTG
CAACAACAGAAGGAAAAAGTTAGGATTACACAGCAAAGTGTCATTATTATCCAATGTCTA
TTGATGTTTTATGTTGTATCAGGAGAAAGGGGTTAAAAAATTTCACTTACACGGTCACCA
TCTTTGATTAGCATGAGGAAAGAAGAAATCTGAGGGAAGATGATTTCATCTAATTTCTCA
GGTCGTTCCACTACTGAATATTTCACAGCAGTAACAACAGTTGCACGGGTAAAAGCAGCT
GGGCTCGTTGTCCTGACCTATAAAATTCAGAATGCATCTCTAAGCATAACAGCAATGAGT
ATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAAT
GTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACG
ATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATT
TCGACGTGTCTACATTCA

Last Updated on 23.10.2014 13:25