SimpleSearch - Line and FST details


Line specific information

 
Line ID 134H10
Vector Used pAC161
Line Availability only available from NASC (N412862)
Segregation Analysis 100:88:66
Confirmed for Hit At2g02560
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At3g45555 can not be ordered because the confirmation of this insertion failed.

Gene hit At3g45555

 
Sequence (A. th genome BLAST matches underlined)
>80-K104607-0022-134-H10-8409
CTTCTGTTCCGAATGCATGAAACAATATATAGAACTGAGGCTCCTATGGCCCCCGTCATA
TAGAAGACCCCAATACCCTGGGGACGAGTGTATCNNGGGGCCTGAAGGGGAGAGTGNGGC
CTTAANACCTCTTANCCAGGAGAACAAAAATTTTGGTTGCAATCCAAATAGGTATATCCC
ATTAGCACCACACAAAAAATAAGATTAGGATATTTTTAACTACAGAACAGAGATTACTTT
ATAAATAATATAATAATTTAAACAAGAAAAACAATAGAATAAGATAAATATAAAATACAT
AATAATTAAAAAAGATAATAGAACATTTATATTAAAAAAGGAACGCAAATCACAATAATA
GGAAAGAAAATAATATATAATAAAAAGTATTAATGTATATAGGTAATATTCAAACTATTA
TTTTAGATAATAGAAGAGTAATAATAAAACCAAAAAGAGATAGATATATAATGTATTAGA
CAAGTTATAATTAGATATAGGAACACAATATATCAATAACATAATATTTATATCAGTAAA
ATATTATCGTAAGATTAGATTATAGTGAATTAATTTAATATCTTATTTATAATAATGATA
ATTAATAATAATTATAAATAAAATAGATATTGACTACGATGATAATTTTTAAATAAAAAC
TATAAATAATAAATATTTTAATATATATTAGAAATTTTAATTATAATTAAGATAAATATA
ATTTAGAGATTGTATAATTAATTATAATATTTAAAAGACTATAATTATAATAGTAAGAAA
GATTATGAGGAATTTGAAATATATTCTATAAATTTATAGTTAGATTTGTTATATTACATA
ATAAATTTATAGAAAATAATTATACAAGAAAATGAGGAATATAATATAGTATTAATAGTG
AAAGATATGTCTATAGTGGAAATAATATATGTATATCAAGTAAAATTAATAAAATAATCG
AAAATTGAGATATTTTAAAAATACATATAATAATATCTTAATACTAAGATTAATTAGACA
TATAAATTGAAATATTAAAACGTATAATATATATCAGAAAAATTAAAAATATATTAAATT
TGACAAAATTATATAAATTATCTAATAACAATTTAATAATGAGGTAAGAGTAGTAGTGAA
TATCAGTAGAAGAGATATGATTAAGTAAATATGATAATCAACAAATTAATATGTTAATTT
TATAAGATTAATCTGTTATATTTAGTAAAAACATGATAT
GenBank Accession FR804009 [GenBank]
Graphic View Graphic view of gene At3g45555
Predicted Position of Insertion Chr3:16712920 - go to primer design
BLAST e Value 2e-04
Hit Clone Code (BAC ID) F9K21
Hit Gene Code At3g45555 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 146A12

Gene hit At2g02560

 
Sequence (A. th genome BLAST matches underlined)
>80-K013053-022-134-H10-35St
ATTGACGTAAGGGATGACGCACTTTCCACTATCCTTCGCAGACCCTTCCTCTATATAAGG
AAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTT
CGGTTTAAACTATCAGTGTTTGACTGAGATCTTTCCTTCTCCCAATCTCACCAAGAGATA
ACAGGGCAAGATGTTGTTTTGCCTGCACGAGAAAACATCAGTACAAAAATAAGCCTTTAA
GTAGCTGTAGATCTACTAAGGAAGATAAAGCCTGAATCTAATTCCCTAATGGCTCTCAAA
CTAACAAAAATTCAAAGTGCTTACTGAATTTGTGCCGCTGTCATCTTTAAGGATTTCCAT
GAGCATTTTAACTGTAGACGAACAATTCTTATCACCCGCTGCGAGACAAAGAACCGCCAC
ACACTGTGCAATTGAATATAGTGCTTGCTTTGGGACACCTCCAGACTGAGGAGAAGGCTT
AGCACAAGATAGCAATGATTCCAGCAAGGTGTAGAAACTCGTATTTGCATGATACACCAG
AGCTTCAAAGAATTTTTGCAGATCCTGTGACAAACATCCAAGAAATCATTGCCTTCTATT
CTTTAAGGTCAGGCAAAGTATATAACAATTCCATCAGTAACAAAAAATTTACCAAAGTGC
TTGACCCTGGNAGCATGGGCTTTTTACTAAAAGTAGTGCCTGGCGAAGAACTTTGGTGCG
GACCGNCAAACTGATTTTTTCACTACAACTCTTTTCAGTCATCAAAGTGCACAAAAGTTC
GAGTGCAAGAGCTGTCATGGGCAGGGTCTGAAACACTGAAAAACACAGACGAAGTCATCT
TTTTATATA
GenBank Accession AL765101 [GenBank]
Graphic View Graphic view of gene At2g02560
Predicted Position of Insertion Chr2:695662 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T8K22
Hit Gene Code At2g02560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cullin-associated and neddylation dissociated
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03