Sequences from confirmation amplicon


Confirmation sequences for line 135A08 and hit At5g59670 are shown.
Line ID 135A08
Locus At5g59670 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:24041604
Primers used for PCR NR71 - 8474, show primer details
   
Sequence Name 01-K102588-0022-135-A08C-8409
GenBank Accession LN486524 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K102588-0022-135-A08C-8409
TTGAATACAAGACCCACAAGGTATCAGATATCGTCTTTGTTCTATATACATCTATGTGTA
GAAACATTTTGGTTATAAGAAAGAAGTGCACTGGTTTTAATGTCTGTTAACAGGGTTCAT
CAGTTTGGATTGCGGGCTACCCGCAAATGAGACGTCTCCTTATACAGAGACTCAAACTGG
TCTGTTGTTCTCTTCGGACGCAACATTCATCCAGAGCGGAAAAACTGGTAGAGTCCAAGC
AAATCAAGAGAGTAAATTCTTGAAGCCATACAGAACGCTGAGATATTTCCCAGAGGGAGT
ACGGAATTGCTACAATCTGAGTGTGTTCAAGGAGCGTAAATATTTGATCGCTGCTAGTTT
TTTATATGGAAATTACGATGGTCATAACATAGCCCCTGTGTTTGATCTTTATCTTGGACC
AAATTTATGGGCGAAAATAGATTTACAAGATGTGAATGGTACAGGGGAAGAGATCTTACA
CATCCCAACATCGAACTCGTTGCAGATATGTCTTGTTCAGACTGGGGAAACTACACCGCT
GATATCCTCTTTGGAATTACGGCCAATGAG
   
Sequence Name 01-K102589-0022-135-A08C-NR71
GenBank Accession LN486525 [GenBank]
Sequencing primer gene specific primer, NR71: 5'-GTATAGCTTCCAGTTCTCATTGGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K102589-0022-135-A08C-NR71
CAGTCTGAACAGACATATCTGCAACGAGTTCGATGTTGGGATGTGTAAGATCTCTTCCCC
TGTACCATTCACATCTTGTAAATCTATTTTCGCCCATAAATTTGGTCCAAGATAAAGATC
AAACACAGGGGCTATGTTATGACCATCGTAATTTCCATATAAAAAACTAGCAGCGATCAA
ATATTTACGCTCCTTGAACACACTCAGATTGTAGCAATTCCGTACTCCCTCTGGGAAATA
TCTCAGCGTTCTGTATGGCTTCAAGAATTTACTCTCTTGATTTGCTTGGACTCTACCAGT
TTTTCCGCTCTGGATGAATGTTGCGTCCGAAGAGAACAACAGACCAGTTTGAGTCTCTGT
ATAAGGAGACGTCTCATTTGCGGGTAGCCCGCAATCCAAACTGATGAACCCTGTTAACAG
ACATTAAAACCAGTGCACTTCTTTCTTATAACCAAAATGTTTCTACACATAGATGTATAT
AGAACAAAGACGATATCTGATACCTTGTGGGTCTTGTATTCAATTGTAAATGGCTTCATG
TCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGA
GTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATG
AAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATA
AACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC
Primers used for PCR MN58 - 8474, show primer details
   
Sequence Name 31-K119006-0022-135-A08C-MN58
GenBank Accession LN500359 [GenBank]
Sequencing primer gene specific primer, MN58: 5'-TGGAACTAAGATTCATGCTGATTG-3'
Sequence (A. th genome BLAST matches underlined)
>31-K119006-0022-135-A08C-MN58
CTTCTCTAGTAAACTAAAGAAAAAGAATATTGTTTGTGATTTCTTAAACAAAATAATTAG
AGACTAATAACCTACGCGATAAAAGAGAACTCACAAATTAGTGAGAGCAAAAAAACTACG
GAAAGGACAGTCTTTAAAGAAAAACACAATAAACAATCAACGAAAAAGGGCAGTCTTGTT
TGGACTGTGATATATCAATGTGTGCTTCTTGGTCCGCTCCTTAGTTTCCCAGAAAAAAAC
TTCATGACGGTGATGTTGGGACATTGTTGTCCTCTTAACCCTCATCTTCTTCCATTGGTG
AAGCTGCCTGCACTAGAAAACATATATACTCATTTTCACCATTGACTTGAGTCCTGACTA
AGTCTTTCTTTTAGTGTATGATATTTGGGTTTGCTTATTTATTTAAAGTTTTATCTTCAA
CAGCATAGCCACCCGTTGGTTTCTTGATTTTTCCTTGGGAGTTAAGAAAAGATGGAGAGT
TCTTTTGGGCTTTTGTTGGCACTGTTAACTTTGACCATCATTCATATTGTTCAATGTAGA
TTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTATCCATACTCATTGCTGTCCG
GTTTAAACAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATTGAACA
ATATGAATGATGGTCAAAGTTAACAGTGCCAACAAAAGCCCAAAAGAACTCTCCATCTTT
TCT
   
Sequence Name 01-K119005-0022-135-A08C-8409
GenBank Accession queueing for submission to ENA/GenBank
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K119005-0022-135-A08C-8409
TTACATTGAATATATCCTCGTTAAACCCGGACACCAATGAGTATGGACTACCATATATTC
CAATTGTAAATAGGCTTCATGTCCGCGGAAATCTACACTGGATCAGCCAATGAGTATGAA
TGGTCAATAT

Last Updated on 07.07.2016 14:16