SimpleSearch - Line and FST details


Line specific information

 
Line ID 135A08
Vector Used pAC161
Line Availability only available from NASC (N412872)
Segregation Analysis 50:30:19
Confirmed for Hit At5g59670
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g59670

 
Sequence (A. th genome BLAST matches underlined)
>31-K119006-0022-135-A08C-8409
AGAAAAGATGGAGAGTTCTTTTGGGCTTTTGTTGGCACTGTTAACTTTGACCATCATTCA
TATTGTTCAATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGTTTA
AACCGGACAGCAATGAGTATGGATAGGATATATTCAATTGTAAATGGCTTCATGTCCGGG
AAATCTACATTGAACAATATGAATGATGGTCAAAGTTAACAGTGCCAACAAAAGCCCAAA
AGAACTCTCCATCTTTTCTTAACTCCCAAGGAAAAATCAAGAAACCAACGGGTGGCTATG
CTGTTGAAGATAAAACTTTAAATAAATAAGCAAACCCAAATATCATACACTAAAAGAAAG
ACTTAGTCAGGACTCAAGTCAATGGTGAAAATGAGTATATATGTTTTCTAGTGCAGGCAG
CTTCACCAATGGAAGAAGATGAGGGTTAAGAGGACAACAATGTCCCAACATCACCGTCAT
GAAGTTTTTTTCTGGGAAACTAAGGAGCGGACCAAGAAGCACACATTGATATATCACAGT
CCAAACAAGACTGCCCTTTTTCGTTGATTGTTTATTGTGTTTTTCTTTAAAGACTGTCCT
TTCCGTAGTTTTTTTGCTCTCACTAATTTGTGAGTTCTCTTTTATCGCGTAGGTTATTAG
TCTCTAATTATTTTGTTTAAGAAATCACAAACAATATTCTTTTTCTTTAGTTTACTAGAG
AAG
GenBank Accession LN713393 [GenBank]
Graphic View Graphic view of gene At5g59670
Predicted Position of Insertion Chr5:24041600 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MTH12
Hit Gene Code At5g59670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03