Sequences from confirmation amplicon


Confirmation sequences for line 149A04 and hit At5g58380 are shown.
Line ID 149A04
Locus At5g58380 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:23598492
Primers used for PCR JK03 - 8474, show primer details
   
Sequence Name 15-K020436-022-149-A04C-8409
GenBank Accession LN492770 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K020436-022-149-A04C-8409
GTTGGGAGGTTATTGGGTCAAGGTACTTTTGCCAAGGTGTATTATGGAAGGAGTATTCTT
ACTAACCAGAGTGTTGCTATCAAGATGATCGATAAGGAAAAGGTTATGAAAGTTGGGCTT
ATCGAACAGATCAAGAGAGAGATCTCTGTTATGAGGATTGCTAGACACCCTAACGTTGTG
GAGCTATATGAGGTCATGGCAACAAAAACGAGGATCTACTTTGTTATGGAGTATTGTAAA
GGTGGAGAGCTTTTCAACAAGGTTGCCAAAGGGAAATTGAGAGATGATGTTGCTTGGAAA
TACTTTTATCAGCTTATCAACGCAGTTGATTTTTGCCACAGCCGAGAGGTGTATCATCGT
GACATAAAGCCGGAGAACCTATTGCTAGATGATAATGAGAATCTCAAGGTATCTGATTTC
GGGTTAAGCGCCCTTGCTGACTGCAAGAGACAAGATGGCCTCCTCCACACTACT
   
Sequence Name 16-K020436-022-149-A04C-JK03
GenBank Accession LN493240 [GenBank]
Sequencing primer gene specific primer, JK03: 5'-TGTACCACAAGTAGTGTGGAGGAG-3'
Sequence (A. th genome BLAST matches underlined)
>16-K020436-022-149-A04C-JK03
CATCTTGTCTCTTGCAGTCAGCAAGGGCGCTTAACCCGAAATCAGATACCTTGAGATTCT
CATTATCATCTAGCAATAGGTTCTCCGGCTTTATGTCACGATGATACACCTCTCGGCTGT
GGCAAAAATCAACTGCGTTGATAAGCTGATAAAAGTATTTCCAAGCAACATCATCTCTCA
ATTTCCCTTTGGCAACCTTGTTGAAAAGCTCTCCACCTTTACAATACTCCATAACAAAGT
AGATCCTCGTTTTTGTTGCCATGACCTCATATAGCTCCACAACGTTAGGGTGTCTAGCAA
TCCTCATAACAGAGATCTCTCTCTTGATCTGTTCGATAAGCCCAACTTTCATAACCTTTT
CCTTATCGATCATCTTGATAGCAACACTCTGGTTAGTAAGAATACTCCTTCCATAATACA
CCTTGGCAAAAGTACCTTGACCCAATAACCTCCCAACATGGATCAGCAATGAGTATGATG
GTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGAT
GTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGT
CGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACG
TGTCTAC

Last Updated on 23.10.2014 13:25