SimpleSearch - Line and FST details


Line specific information

 
Line ID 149A04
Vector Used pAC161
Line Availability only available from NASC (N414212)
Segregation Analysis 100:59:37
Confirmed for Hit At5g58380
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g58380

 
Sequence (A. th genome BLAST matches underlined)
>25-K013072-022-149-A04-8409
ATGTTGGGAGGTTGTTGGGTACAGGCTCTTTTGCCTGGTGTATTATGGAAGGAGTCTTCT
TACTAACCGCAGTGTTGCTATCAAGATGATCGATACACGGAAAAGGTTATGAAAGTTGGG
CTTATCGAACAGATCAAGAGAGAGATCTCTGTTATGAGGATTGCTATGGGATCCTCCCTA
TAGTGAG
GenBank Accession AL757483 [GenBank]
Graphic View Graphic view of gene At5g58380
Predicted Position of Insertion Chr5:23598494 - go to primer design
BLAST e Value 3e-54
Hit Clone Code (BAC ID) MCK7
Hit Gene Code At5g58380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SOS3-interacting protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40