Sequences from confirmation amplicon


Confirmation sequences for line 149G04 and hit At5g07010 are shown.
Line ID 149G04
Locus At5g07010 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:2175453
Primers used for PCR FV04 - 8474, show primer details
   
Sequence Name 25-K023373-022-149-G04C-8409
GenBank Accession LN497265 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>25-K023373-022-149-G04C-8409
AGATTTCCCGGACATGAAGCCATTTACAATTGAATATATTCATCAATTGGTACTTGTGTC
ATTGCTGAATCCATTGGTAATTGATTGCTCATCTCTTCGTGGCATTACACCAACAACATC
AAATCCGAGTCAGTGAGCCCAGTCTTGCTAGACCAAGCTTTTGATCTGTATTGCCGGGGA
GTGATCGGGTTTGGCCCGTTTTGGGAACACATGTTGGGATACTGGAGAGAGAGCTTGAAG
AGACCAGAGAAAGTCTTCTTTTTAAGGTACGAGGATCTCAAAGACGACATCGAGACCAAC
TTGAAGAGGCTTGCAACTTTCTTAGAGCTTCCTTTCACCGAAGAAGAGGAACGAAAGGGA
GTTGTGAAGGCTATCGCCGAGCTGTGTAGCTTCGAGAATCTGAAGAAGTTGGAGGTGAAC
AAGTCAAACAAGTCGATCAAGAACTTTGAGAATCGATTCTTGTTTCGGAAAGGAGAAGTG
AGTGATTGGGTTAACTATTTGTCACCTTCACAAGTGGAAAGATTGTCA
   
Sequence Name 26-K023373-022-149-G04C-FV04
GenBank Accession LN497742 [GenBank]
Sequencing primer gene specific primer, FV04: 5'-ATCCACTAAGGCTGACAATCTTTC-3'
Sequence (A. th genome BLAST matches underlined)
>26-K023373-022-149-G04C-FV04
GTGACAAATAGTTAACCCAATCACTCACTTCTCCTTTCCGAAACAAGAATCGATTCTCAA
AGTTCTTGATCGACTTGTTTGACTTGTTCACCTCCAACTTCTTCAGATTCTCGAAGCTAC
ACAGCTCGGCGATAGCCTTCACAACTCCCTTTCGTTCCTCTTCTTCGGTGAAAGGAAGCT
CTAAGAAAGTTGCAAGCCTCTTCAAGTTGGTCTCGATGTCGTCTTTGAGATCCTCGTACC
TTAAAAAGAAGACTTTCTCTGGTCTCTTCAAGCTCTCTCTCCAGTATCCCAACATGTGTT
CCCAAAACGGGCCAAACCCGATCACTCCCCGGCAATACAGATCAAAAGCTTGGTCTAGCA
AGACTGGGCTCACTGACTCGGATTTGATGTTGTTGGTGTAATGCCACGAAGAGATGAGCA
ATCAATTACCAATGGATTCAGCAATGACACAAGTACCAATTGATGAATATATTCAATTGT
AAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTGAATATGG
AGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCG
TTTTTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATA
GGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATT

Last Updated on 07.07.2016 14:16