SimpleSearch - Line and FST details


Line specific information

 
Line ID 149G04
Vector Used pAC161
Line Availability only available from NASC (N414284)
Segregation Analysis 100:38:30
Confirmed for Hit At5g07010
Parent of DUPLO pair none
Parent of pair(s) 9560

Gene hit At5g07010

 
Sequence (A. th genome BLAST matches underlined)
>31-K013072-022-149-G04-8409
GTGATCCATGTAGATTNTCCCGGACTGAANGCCTTTACAATTGAAATTCAGATGCTATGG
GATCCTCCCTATAGGGAGTCGCATTACTCAATTGATTGCTCATCTCTTCGTGGCATTACA
CCAACAACATCAAATCCGAGTCAGTGAGCCCAGTCTTGCTATGGGATCCTCCCTATAGTG
AGTCGATNTACTCAACTATGGGATCCTCCCTATAGTGAGTCGTATTACTCAGTCCGCGTG
AGGGGTCCTACGCAAAAATTTACCCCCCCCCCCCGGGTTCTTCTTTAAAAATG
GenBank Accession AL757528 [GenBank]
Graphic View Graphic view of gene At5g07010
Predicted Position of Insertion Chr5:2175453 - go to primer design
BLAST e Value 9e-27
Hit Clone Code (BAC ID) MOJ9
Hit Gene Code At5g07010 [TAIR] [MIPS] [SIGnAL]
Gene Annotation sulfotransferase 2A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23