Sequences from confirmation amplicon


Confirmation sequences for line 151C05 and hit At5g52545 are shown.
Line ID 151C05
Locus At5g52545 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:21323839
Primers used for PCR RU13 - 8474, show primer details
   
Sequence Name 33-K023020-022-151-C05C-8409
GenBank Accession LN500827 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>33-K023020-022-151-C05C-8409
AGATTTCCCGGACATGAAGCCATTTACAATTAAATCAAAATTGGTTTCGATTAAACCGGT
AAACCAAATCAAATCAAACCAAAACTGAAAAATGGTCAGAGTCACAGAGTCACATAGACC
CAAAGTTGTGTGTTTGAAAACCGTTTTCTTAAATTTTCTGTTTCTTGGGATCACGTTTCT
CATCTTCTTCCAAAGCTTTGAGTTTGTTCTTAATGGCAGTTACTTTTTCGTCTCGGCTCA
TTTGTCCTGAGCTGCTCCCGTTTACAAATCTGGTTCTGTTTCCTTCTGGTAATGATCTTT
TGGAGTGATCATGAGAGGAATCTTCTAGATGCTTCTCACTAGCTAGACGCACCACTAAAG
GCCTACCACAAGCTAATCTCCCATGCATCTTCTCTTTCGCCAATTCAGCTTCCTGTATGC
TCACTTTAGATGTAGAAATCAGGAGATTGCTCAATCAAAATCAAAACATTTTTCATTTCT
TGAAACAATTTCATCCAAGTACAAATGCAAAACCAAGAGAGCCAGATTGTTAGTTACCTC
TTTAAGGCTGTATTGAATGAAAGCATAACCCCGAGGTTCTCCTTTCTTTGGCCCGCGTGT
GTGCC
   
Sequence Name 34-K023020-022-151-C05C-RU13
GenBank Accession LN501251 [GenBank]
Sequencing primer gene specific primer, RU13: 5'-ATATCAGAAGACTTCCTTTGGCAC-3'
Sequence (A. th genome BLAST matches underlined)
>34-K023020-022-151-C05C-RU13
CGGGCCAAAGAAAGGAGAACCTCGGGGTTATGCTTTCATTCAATACAGCCTTAAAGAGGT
AACTAACAATCTGGCTCTCTTGGTTTTGCATTTGTACTTGGATGAAATTGTTTCAAGAAA
TGAAAAATGTTTTGATTTTGATTGAGCAATCTCCTGATTTCTACATCTAAAGTGAGCATA
CAGGAAGCTGAATTGGCGAAAGAGAAGATGCATGGGAGATTAGCTTGTGGTAGGCCTTTA
GTGGTGCGTCTAGCTAGTGAGAAGCATCTAGAAGATTCCTCTCATGATCACTCCAAAAGA
TCATTACCAGAAGGAAACAGAACCAGATTTGTAAACGGGAGCAGCTCAGGACAAATGAGC
CGAGACGAAAAAGTAACTGCCATTAAGAACAAACTCAAAGCTTTGGAAGAAGATGAGAAA
CGTGATCCCAAGAAACAGAAAATTTAAGAAAACGGTTTTCAAACACACAACTTTGGGTCT
ATGTGACTCTGTGACTCTGACCATTTTTCAGTTTTGGTTTGATTTGATTTGGTTTACCGG
TTTAATCGAAACCAATTTTGATTTAATTGTAAATGGCTTCATGTCCGGGAAATCTACATG
GATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTT
TTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAA
AACGACAAATTACGATCCGTCGTATTTATAGGGCGAAAGCAATAAA

Last Updated on 07.07.2016 14:16