SimpleSearch - Line and FST details


Line specific information

 
Line ID 151C05
Vector Used pAC161
Line Availability only available from NASC (N414429)
Segregation Analysis 150:57:55
Confirmed for Hit At5g52545
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At3g11770 can not be ordered because the confirmation of this insertion failed.

Gene hit At3g11770

 
Sequence (A. th genome BLAST matches underlined)
>35-K013138-022-151-C05-8409
TTTTGATCCATTGTAGATTTCCCTGGACATGAANGCCTTTACAATTGAATATATCCTGCC
ATTGATCCATCTAATGATCGTCTTGAAGCTGCTGCCATTGAAGGTTGGCTTATTTTCAAT
GTCTACGATCAATTGCAGCAGTGATTTTTCGTGGCAGTGTTCTTCATGTAACTCTTATGT
TAACCTTCTTGATCTAATGGATTTGTGAGATTGCGCTTGATTGCGCTTGATTGATTCATG
TTGTGTATTGTGATGAGTGAACAATACTGTCTGAATAAAACATGCCCGGCCTTGTCTTTT
TGTCTGAAGATTTTGAGATTATGGTACAATGCCAAAATTTTAAGCTGTAAAAACATAATG
AACCAAAAAGAGACAGCGAAATAGAACGAGCAAAAATGTAAATTCCTTGGATAGTTAGAT
ACAAACTGGTTTAACTCTAAATCACATTCACAAGTTAGTTACAAAACTTACAAGAAACTC
AACAAAACGTTAGCAACTCTGCCTATGGGATCTC
GenBank Accession AL757645 [GenBank]
Graphic View Graphic view of gene At3g11770
Predicted Position of Insertion Chr3:3721564 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F26K24
Hit Gene Code At3g11770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Polynucleotidyl transferase, ribonuclease H-like superfamily protein
Insertion Classification CDSi
Confirmation Status failed

Gene hit At5g52545

 
Sequence (A. th genome BLAST matches underlined)
>35-K013133-022-151-C05-8409
TTGATCCATGTAGATTTCCCNGACATGCAAGCCTCTACTGTTATACACAAGATTCTTGCG
ATCTAATATCTCTGGCTCCAAGGAACTCAACAGGTTGCAGATCCTCGGGCTTTCGCAGCT
ATGGGATCCTCCTTATAGTGACAATGTACAGCTCTGGGTTCCCAATGTACGTGCTATCCA
GCNAGAAAGAGACCTTTTCTACCTTTATCCCCTGCTATGGGATCCTCCTAAAATGACTTT
TTCGTCTCGGCTCATTTGTCCTGAGCTGCTCCCGTTTACAAATCTGGTTCTGTTTCCTTC
TGGTAATGATCTTTTGGAGTGATCATGAGAGGAATCTTCTATGGGATCCT
GenBank Accession AL757644 [GenBank]
Graphic View Graphic view of gene At5g52545
Predicted Position of Insertion Chr5:21323855 - go to primer design
BLAST e Value 4e-53
Hit Clone Code (BAC ID) T4M5
Hit Gene Code At5g52545 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNA-binding protein-like RNA recognition motif protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03