Sequences from confirmation amplicon


Confirmation sequences for line 152D07 and hit At4g19100 are shown.
Line ID 152D07
Locus At4g19100 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:10454312
Primers used for PCR IW18 - 8474, show primer details
   
Sequence Name 19-K016205-022-152-D07C-8409
GenBank Accession LN494542 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>19-K016205-022-152-D07C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGGATATTGGCCTG
TCTTTTGGCAGTCCTTTTGGAATTCCTCAGACAAGAGATAGACTATGCAATAAAAGCTCT
TTGGTTTTATAAACAGATGTAAATTTTGCTGAGGATTTACTTTGGAGATTTTCTATCGAC
GGGCTTCTTCTGCATATCTCTTCGAAAATTTCTTTACCGATCCTAAAGGGTCTGAATTAG
TGAATAGTATCAAATTTATTGCAAACAAATAGACCCAAGTCGATCTTTATTGCAAACCAA
ATTGTCACACACGCAAAAAACAAACCTTAACAATACAGAAATTAAGAAAAGAAAACAAAA
GCAGAACCATTGACGAGGCAAAGACGCGCCGTCGAAAAAAAAAGAAAAAAGGAGACTTGT
TTTTTCTGATGATGTATAAGATTATTAGAGAGTTTATAAAGTAAAATATTTGCTCAGAAG
AGGCATGCTTGAGTTACTATTGGTTTAGGGGTCATCCGGCGACTTTCCTAGAGTAGGCAT
TGGTGGTGGGTTGTGTTGGT
   
Sequence Name 20-K016205-022-152-D07C-IW18
GenBank Accession LN494992 [GenBank]
Sequencing primer gene specific primer, IW18: 5'-GACATGTTCCTTAGACCAACACAA-3'
Sequence (A. th genome BLAST matches underlined)
>20-K016205-022-152-D07C-iw18
CCCACCACCAATGCCTACTCTAGGAAAGTCGCCGGATGACCCCTAAACCAATAGTAACTC
AAGCATGCCTCTTCTGAGCAAATATTTTACTTTATAAACTCTCTAATAATCTTATACATC
ATCAGAAAAAACAAGTCTCCTTTTTTCTTTTTTTTTCGACGGCGCGTCTTTGCCTCGTCA
ATGGTTCTGCTTTTGTTTTCTTTTCTTAATTTCTGTATTGTTAAGGTTTGTTTTTTGCGT
GTGTGACAATTTGGTTTGCAATAAAGATCGACTTGGGTCTATTTGTTTGCAATAAATTTG
ATACTATTCACTAATTCAGACCCTTTAGGATCGGTAAAGAAATTTTCGAAGAGATATGCA
GAAGAAGCCCGTCGATAGAAAATCTCCAAAGTAAATCCTCAGCAAAATTTACATCTGTTT
ATAAAACCAAAGAGCTTTTATTGCATAGTCTATCTCTTGTCTGAGGAATTCCAAAAGGAC
TGCCAAAAGACAGGCCAATATCCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGA
AATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTA
CCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTAC
ATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAAT
TATTCTAATTCGGAAATCT

Last Updated on 07.07.2016 14:16