SimpleSearch - Line and FST details


Line specific information

 
Line ID 152D07
Vector Used pAC161
Line Availability only available from NASC (N414539)
Segregation Analysis 100:95:73
Confirmed for Hit At4g19100
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g19100

Sequence (A. th genome BLAST matches underlined)
>52-K013139-022-152-D07-8409
CTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGGATAT
TGGCCTGTCTTTTGGCAGTCCTTTTGGAATTCCTCAGACAAGAGATAGACTATGCAATAA
AAGCTCTTTGGTTTTATAAACAGATGTAAATTTTGCTGAGGATTTACTTTGGAGATTTTC
TATCGACGGGCTTCTTCTGCATATCTCTTCGAAAATTTCTTTACCGATCCTAAAGGGTCT
GAATTAGTGAATAGTATCAAATTTATTGCAAACAAATAGACCCAAGTCGATCTTTATTGC
AAACCAAATTGTCACACACGCAAAAAACAAACCTTAACAATACAGAAATTAAGAAAAGAA
AACAAAAGCAGAACCATTGACGAGGCAAAGACGCGCCGTCGAAAAAAAAAGAAAAAAGGA
GACTTGTTTTTTCTGATGATGTATAAGATTATTAGAGAGTTTATAAAGTAAAATATTTGC
TCAGAAGAGGCATGCTTGAGTTACTATTGGTTTAGGGGTCATCCGGCGACTTTCCTATGG
GATCC
GenBank Accession BX572194 [GenBank]
Graphic View Graphic view of gene At4g19100
Predicted Position of Insertion Chr4:10454310 - go to primer design
BLAST e Value 6e-145
Hit Clone Code (BAC ID) F13C5
Hit Gene Code At4g19100 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein of unknown function (DUF3464)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Armbruster et al. 2010, pam68-1]


Last Updated on 14.10.2014 10:23