Sequences from confirmation amplicon


Confirmation sequences for line 158C08 and hit At5g61980 are shown.
Line ID 158C08
Locus At5g61980 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:24897106
Primers used for PCR HF04 - 8474, show primer details
   
Sequence Name 33-K024453-022-158-C08C-8409
GenBank Accession LN500838 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>33-K024453-022-158-C08C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGATATCTCTCTAT
AAGTCGACTTCCATTTCCCTGATACATAGAGCTTCAAAGATTCAGTAAAGATACAGTACA
TCACCAATCTGATCTATATATGTTTTCTCAAGGAAGGATCAAAAACACAATTGTTTTTGG
TTTTGCAACTTACTGAAGACCAATTCCATGGCTTGCGGTAATAGTATAGCATCCCACGGC
TATCAAGGATAAAGAATCTTCTTTTCCAGTCACCTCTCAAGTTTGAGGAACGTTTAGACA
GATACCCTTGTCTGATAGTCTGAACCTGAAGAACAGTTATATCAACAGATAAATATAAAA
CAAGAGAGTATAAAGATGTGACAGCAGTTTGACGAGTAAGCCTCAATACAAAAGATATTT
CCTTACCTTTCCTTTTGCAGCAGATTGCATCACGGCCTCGATGACTTTCTGGGAGTTTCT
TGAGTTATGTCTCATGCCATCCCCTGTTGGAGAAACACAGGAGTTTCTAGTTTCACGATC
AACTTGCCTTTGGTATTCCTGCATCCTTTCATTAAGTGATGCCATCTCATAGTTTGCACA
TTCTCTAGAC
   
Sequence Name 34-K024453-022-158-C08C-HF04
GenBank Accession LN501260 [GenBank]
Sequencing primer gene specific primer, HF04: 5'-GCTTATGCACACCAGTCTAGAGAA-3'
Sequence (A. th genome BLAST matches underlined)
>34-K024453-022-158-C08C-hf4
CAAACTATGAGATGGCATCACTTACTGAAAGGATGCAGGAATACCAAAGGCAAGTTGATC
GTGAAACTAGAAACTCCTGTGTTTCTCCAACAGGGGATGGGATGAGACATAACTCAAGAA
ACTCCCAGAAAGTCATCGAGGCCGTGATGCAATCTGCTGCAAAAGGAAAGGTAAGGAAAT
ATCTTTTGTATTGAGGCTTACTCGTCAAACTGCTGTCACATCTTTATACTCTCTTGTTTT
ATATTTATCTGTTGATATAACTGTTCTTCAGGTTCAGACTATCAGACAAGGGTATCTGTC
TAAACGTTCCTCAAACTTGAGAGGTGACTGGAAAAGAAGATTCTTTATCCTTGATAGCCG
TGGGATGCTATACTATTACCGCAAGCCATGGAATTGGTCTTCAGTAAGTTGCAAAACCAA
AAACAATTGTGTTTTTGATCCTTCCTTGAGAAAACATATATAGATCAGATTGGTGATGTA
CTGTATCTTTACTGAATCTTTGAAGCTCTATGTATCAGGGAAATGGAAGTCGACTTATAG
AGAGATATCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATC
AGCAATGA

Last Updated on 07.07.2016 14:16