SimpleSearch - Line and FST details


Line specific information

 
Line ID 158C08
Vector Used pAC161
Line Availability only available from NASC (N415104)
Segregation Analysis 50:48:44
Confirmed for Hit At5g61980
Parent of DUPLO pair none
Parent of pair(s) 97153

Gene hit At5g61980

 
Sequence (A. th genome BLAST matches underlined)
>59-K013215-022-158-C08-8409
NTGATCCATTGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATCTGCTAGAGTT
TTCTCAATCTAGACGTTACATAAACTATGAACCAAAACGTTTCAGAACCTATGAAATACA
CTACGGCTTACGGCTCACATCGATATCTCGTCCTATCAAGGAAGGATCAAAAACACAATT
GTTTTTGGTTTTGCAACTTACTGAAGACCAATTCCATGGCTTGCGGTAATAGTATACCAT
CCCACGGCTATCAAGGATAAAGAATCTTCTTTTCCAGTCACCTCTCAAGTTTGAGGAACG
TTTATACAGATACCCTTGTCTGATAGTCTGAACCTGAAGAACAGTTATATCAACAGATAA
ATATAAAACAAGAGAGTATAAAGATGTGACAGCAGTTTGACGAGTAAGCCTCAATACAAA
AGATATTTCCTTACCTTTCCTTTTGCAGCAGATTGCATCACGGCCTCGATGACTTTCTGG
GAGTTTCTTGAGTTATGTCTCATGCCATCCCCTGTTGGAGAAACACAGGAGTTTCTATGG
GATCCTCCTATTAANGGAANANACTNNTGNNTGAACTGTTCCCCAGTCTTTACGGGGAAA
TCTGGTAAGGTCCTCTATTCGAATCTTTGACTTCCTTGGGGAATGGGGGATC
GenBank Accession AL758399 [GenBank]
Graphic View Graphic view of gene At5g61980
Predicted Position of Insertion Chr5:24897120 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) K22G18
Hit Gene Code At5g61980 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARF-GAP domain 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit MJK13

 
Sequence (A. th genome BLAST matches underlined)
>59-K013242-022-158-C08-8409
TTGATCCATGTAGATTNTCCCGGACATGAANGCACTTTACANTTGAATATCGGAAAGAGA
TTATTCACAATCTACATCGTTGCATACTACTACTAAACTAAAACGTCACAGAACCTATGA
AATATCATACGGCTTACGGCTCACATATGGTGAGCCTGACTTATAGTGAACAAGCTATAA
AAGGAAAGCACGAGTGTTTAGCGGACGCATTAGTCGAGTAAATATTTATTTAACTTGGAT
ATTATTTCTTTATCATAAGAATAGTCGTCGGATGTTAAGGAGAAAGTAAAACAAATGAAC
GGCGTCAGATACAGAAAATCTGTTTAAAGTATGCCAAAGTAAAACTATAGGGTTTGGTTC
GATATCTTGTTGGGCTTTCGATTCGGTAGCTTCTAACCCAATCTTCCGACATATGGCCCG
TTTCTGCGGATATATTAAACATTATTTTTCTCCTATGGGATCCTC
GenBank Accession AL758400 [GenBank]
Graphic View Graphic view of sequence AL758400 of line 158C08
Predicted Position of Insertion Chr3:5261475 - go to primer design
BLAST e Value 4e-161
Hit Clone Code (BAC ID) MJK13
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23