Sequences from confirmation amplicon


Confirmation sequences for line 161G03 and hit At1g51490 are shown.
Line ID 161G03
Locus At1g51490 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:19096671
Primers used for PCR VL17 - 8474, show primer details
   
Sequence Name 49-K017367-022-161-G03C-VL17
GenBank Accession LN506667 [GenBank]
Sequencing primer gene specific primer, VL17: 5'-GAGTGTAACCATTTCCGAATTCAT-3'
Sequence (A. th genome BLAST matches underlined)
>49-K017367-022-161-G03C-vl17
CATCAATGACCATGCTCAATATCCTGCTACGTTGCATCCATCCCTATTAAATATTTAAGA
AAATAGTTTTGATATGAATATAAATTTATAATTCTCCGAAGACAGTAAATCACATAAAAT
ACGAATGATATATTAAACTCACTCAATTGCGCATTTGAGACAAGAAAGATGGCTGCATTG
AAATTGAATTCGTCCATTATCGGCAAGAGCATTTGCGATCAGCATCAGCAACTCCTACAA
ATTGACATAAGATTTGTAACTAACACAAAATAGTTTTTTCATTGGTTAAAGTTAAACATT
TGAATGCAACATATACCGTTTTCGGTGATGTAGGTTAATGGATTCTTGTACTTGTTTTTG
ATGTGATTTAGAATCTGACGGAATCCTGGTGGATAGTAGGAGAAGCTCGACAAATAAAAA
AAAATCAACTAAATGTCGTAAATCTTTCACATCTGGGAAAAAAAATATACGAAACCAAAG
TTGATACTAGCCTTAACACCAATAGAAACTCCATTTCGCTCAACTGAAACCAATTATAAA
AAGATTAGTTTTGGTGATTTATATATGAAAAATCCACCTAAATACGACAAATGTTTGACA
TATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATG
ATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATG
   
Sequence Name 53-K017367-022-161-G03C-8409
GenBank Accession LN507986 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>53-K017367-022-161-G03C-8409
TAGATTTCTCCGACATGAAGCCATTTACAATTGAATATATGTCAAACATTTGTCGTATTT
AGGTGGATTTTTCATATATAAATCACCAAAACTAATCTTTTTATAATTGGTTTCAGTTGA
GCGAAATGGAGTTTCTATTGGTGTTAAGGCTAGTATCAACTTTGGTTTCGTATATTTTTT
TTCCCAGATGTGAAAGATTTACGACATTTAGTTGATTTTTTTTTATTTGTCGAGCTTCTC
CTACTATCCACCAGGATTCCGTCAGATTCTAAATCACATCAAAAACAAGTACAAGAATCC
ATTAACCTACATCACCGAAAACGGTATATGTTGCATTCAAATGTTTAACTTTAACCAATG
AAAAAACTATTTTGTGTTAGTTACAAATCTTATGTCAATTTGTAGGAGTTGCTGATGCTG
ATCGCAAATGCTCTTGCCGATAATGGACGAATTCAATTTCAATGCAGCCATCTTTCTTGT
CTCAAATGCGCAATTGAGTGAGTTTAATATATCATTCGTATTTTATGTGATTTACTGTCT
TCGGAGAATTATAAATTTATATTCATATCAAAACTATTTTCTTAAATATTTAATAGGGAT
GGATGCAACGTAGCAGGATATTTTGCATGGTCATTGATGGACAATTATGAATTCGG
Primers used for PCR AN05 - 8474, show primer details
   
Sequence Name 33-K105775-0022-161-G03C-AN05
GenBank Accession LN500999 [GenBank]
Sequencing primer gene specific primer, AN05: 5'-ACTGACTGTGAATTTGGAGGAGAT-3'
Sequence (A. th genome BLAST matches underlined)
>33-K105775-0022-161-G03C-AN05
GAACTTCTGGCTCATATGGAAGCTGTATCTTTATACCGAAAAAGATATCAGGTATACATA
CCGTAAACTCATAATTTCTCTTTGCGTCGATACTACTTTGTGGTATATTTGAGTCTATAA
TCAAGAACTACTTACGCAGAAATTTCAAGGTGGTAAGATAGGAACGACATTGATCGGTAG
ATGGTTCATCCCACTAAATGAAACTAACGATCTCGACAAGGCTGCTGCAAAACGAGAATT
CGATTTTTCCGTTGGCTGGTATATATGTTCAACTCATGGATTACCAAAACATTAATTATG
TATATATAAAACATGCTGTGCAATATTAATTTATGTATATTTTCTTACATATGTGTAGGT
TCTTGGATCCACTGGTGTACGGACAATATCCAAAGATAATGAGAGACTAGGAGATAGATT
GCCAAAATTCACGCCCAAGCAATCAGCTTTACTTAAAGGATCACTTGATTTTCTAGGGTT
GAACTATTACGTTACAAGATATGCAACCTACAGACCTCCTGAATTGTAAATGGCTTCATG
TCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGA
GTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGGTTATT
   
Sequence Name 40-K105776-0022-161-G03C-8409
GenBank Accession LN503711 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>40-K105776-0022-161-G03C-8409
GAGCCATTTACATTCAGGAGGTCTGTAGGTTGCATATCTTGTAACGTAATAGTTCAACCC
TAGAAAATCAAGTGATCCTTTAAGTAAAGCTGATTGCTTGGGCGTGAATTTTGGCAATCT
ATCTCCTAGTCTCTCATTATCTTTGGATATTGTCCGTACACCAGTGGATCCAAGAACCTA
CACATATGTAAGAAAATATACATAAATTAATATTGCACAGCATGTTTTATATATACATAA
TTAATGTTTTGGTAATCCATGAGTTGAACATATATACCAGCCAACGGAAAAATCGAATTC
TCGTTTTGCAGCAGCCTTGTCGAGATCGTTAGTTTCATTTAGTGGGATGAACCATCTACC
GATCAATGTCGTTCCTATCTTACCACCTTGAAATTTCTGCGTAAGTAGTTCTTGATTATA
GACTCAAATATACCACAAAGTAGTATCGACGCAAAGAGAAATTATGAGTTTACGGTATGT
ATACCTGATATCTTTTTCGGTATAAAGATACAGCTTCCATATGAGCCAGAAGTTCGTGAT
GTCCAACTATATAAGGTTCAGTTCCAGAATCTCCTCCAAATTCACAGTCAG

Last Updated on 07.07.2016 14:16