SimpleSearch - Line and FST details


Line specific information

 
Line ID 161G03
Vector Used pAC161
Line Availability only available from NASC (N415435)
Segregation Analysis 100:99:67
Confirmed for Hit At1g51490
Parent of DUPLO pair none
Parent of pair(s) 1423, 69984, 70435

Gene hit At1g51490

 
Sequence (A. th genome BLAST matches underlined)
>23-K013267-022-161-G03-8409
GTGATCCATGTAGATTNTCCCGGACATGAAGCACTTTACAATTGAATATATGTCAAACAT
TTGTCGTATTTAGGTGGATTTTTCTATATAAATCACCAAAACTAATCTTTTTATAATTGG
TTTCAGTTGAGCGAAATGGAGTTTCTATTGGTGTTAAGGCTATGGGATCCTCCTAATAGT
GA
GenBank Accession BX649754 [GenBank]
Graphic View Graphic view of gene At1g51490
Predicted Position of Insertion Chr1:19096712 - go to primer design
BLAST e Value 1e-56
Hit Clone Code (BAC ID) F5D21
Hit Gene Code At1g51490 [TAIR] [MIPS] [SIGnAL]
Gene Annotation beta glucosidase 36
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX649755 [GenBank]


Last Updated on 14.10.2014 10:23