Sequences from confirmation amplicon


Confirmation sequences for line 164F12 and hit At2g46270 are shown.
Line ID 164F12
Locus At2g46270 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:19002694
Primers used for PCR Z55b - 8474, show primer details
   
Sequence Name 26-K014584-022-164-F12C-8409
GenBank Accession LN497689 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>26-K014584-022-164-F12C-8409
CCATGTAGATTTCCCGTACATGTAGATTTCATTTACTTCATAAAGATAATTTGTTGGTTA
ATGATAGCTTACTTACCAACAAGGTTGCATTTGCTCCTCTTAGTTTATCAGATTTCTCAT
TAAGTTGGTTTAGTTCAGATCTTAATGCCATGTTTTCGGCTGTCAAGGCTTCCACTTTCC
TAGCAAGTTCTTCTGTCTCGGCCTTCAAAACAAGGAAAGACAGTTTGTTAGTTTATTAAA
TGTTTTGGTGAGAGTTACACACTAAGAGAAAGAATTTCTAAAGAGCTTCAGTGTATTCTT
TCAGTAACCAAACCTGTTTCCTTAATCTTGACCTTCTAGCAGATTCTCTATTAGACTGTT
TCCTTCGCTCCCGTTTCAGTTCTCTCTCGTTCTGAAGACAAAATTTAATACTTGGTCAGG
GAAACGGATCAGATTAGCTCGAAAATCCAACAAGTGGAAGTTGAGAATAAGTCACAGGGT
ACCTGAAGCCAAGTTTCAGGAGGAACCATGGCTAAAGATTGTGACATGAAGGGGTTGGAA
TTTGCACTTACACCAGGAGAGAGTATAGCTCCAGATCCTTGAATGAGTTTTACGCCGGTA
TCACCACTTGACGGAGAAACAGAATGAAATGAGCTAGCTTGAACCAATTGTTTCCCATCT
GCCAAAAAAACCGAATTAAAACTCCCATTATATCTAATATTTACACTGATTC
   
Sequence Name 27-K014584-022-164-F12C-Z55b
GenBank Accession LN498154 [GenBank]
Sequencing primer gene specific primer, Z55b: 5'-TCATGTCCCAAAGAGTTAGAATCA-3'
Sequence (A. th genome BLAST matches underlined)
>27-K014584-022-164-F12C-Z55b
AGATATAATGGGAGTATTAATCCGGTTTTTTTGGCAGATGGGAAACAATTGGTTCAAGCT
AGCTCATTTCATTCTGTTTCTCCGTCAAGTGGTGATACCGGCGTAAAACTCATTCAAGGA
TCTGGAGCTATACTCTCTCCTGGTGTAAGTGCAAATTCCAACCCCTTCATGTCACAATCT
TTAGCCATGGTTCCTCCTGAAACTTGGCTTCAGGTACCCTGTGACTTATTCTCAACTTCC
ACTTGTTGGATTTTCGAGCTAATCTGATCCGTTTCCCTGACCAAGTATTAAATTTTGTCT
TCAGAACGAGAGAGAACTGAAACGGGAGCGAAGGAAACAGTCTAATAGAGAATCTGCTAG
AAGGTCAAGATTAAGGAAACAGGTTTGGTTACTGAAAGAATACACTGAAGCTCTTTAGAA
ATTCTTTCTCTTAGTGTGTAACTCTCACCAAAACATTTAATAAACTAACAAACTGTCTTT
CCTTGTTTTGAAGGCCGAGACAGAAGAACTTGCTAGGAAAGTGGAAGCCTTGACAGCCGA
AAACATGGCATTAAGATCTGAACTAAACCAACTTAATGAGAAATCTGATAAACTAAGAGG
AGCAAATGCAACCTTGTTGGTAAGTAAGCTATCATTAACCAACAAATTATTTTTTATGAA
GTAAATGAAATCTACATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAA
TATG
Primers used for PCR AJ16 - 8474, show primer details
   
Sequence Name 04-K105456-0022-164-F12C-AJ16
GenBank Accession LN487915 [GenBank]
Sequencing primer gene specific primer, AJ16: 5'-AACAATTGGTTCAAGCTAGCTCAT-3'
Sequence (A. th genome BLAST matches underlined)
>04-K105456-0022-164-F12C-AJ16
TCTGGAGCTACACTCTCTCCTGGTGTAAGTGCAAATTCCAACTCCTTCATGTCACAATCT
TTAGCCATGGTTCCTCCTGAAACTTGGCTTCAGGTACCCTGTGACTTATTCTCAACTTCC
ACTTGTTGGATTTTCGAGCTTCTCTGAGCCGTTTCCCTGACCAAGTATTAAATTTTGTCT
TCAGAACGAGAGAGAACTGAAACGGGAGCGAAGGAAACAGTCTAATAGAGAATCTGCTAG
AAGGTCAAGATTAAGGAAACAGGTTTGGTTACTGAAAGAATACACTGAAGCTCTTTAGAA
ATTCTTTCTCTTAGTGTGTAACTCTCACCAAAACATTTAATAAACTAACAAACTGTCTTT
CCTTGTTTTGAAGGCCGAGACAGAAGAACTTGCTAGGAAAGTGGAAGCCTTGACAGCCGA
AAACATGGCATTAAGATCTGAACTAAACCAACTTAATGAGAAATCTGATAAACTAAGAGG
AGCAAATGCAACCTTGTTGGTAAGTAAGCTATCATTAACCAACAAATTATCTTTATGAAG
TAAATGAAATCTACATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAAT
ATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGC
AGCGTTATTA
   
Sequence Name 20-K105457-0022-164-F12C-8409
GenBank Accession LN495210 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>20-K105457-0022-164-F12C-8409
ATTTCATTTACTTCATAAAGATAATTTGTTGGTTAATGATAGCTTACTCACCAACAAGGT
TGCATTTGCTCCTCTTAGTTTATCAGATTTCTCATTAAGTTGGTTTAGTTCAGATCTTAA
TGCCATGTTTTCGGCTGTCAAGGCTTCCACTTTCCTAGCAAGTTCTTCTGTCTCGGCCTT
CAAAACAAGGAAAGACAGTTTGTTAGTTTATTAAATGTTTTGGTGAGAGTTACACACTAA
GAGAAAGAATTTCTAAAGAGCTTCAGTGTATTCTTTCAGTAACCAAACCTGTTTCCTTAA
TCTTGACCTTCTAGCAGATTCTCTATTAGACTGTTTCCTTCGCTCCCGTTTCAGTTCTCT
CTCGTTCTGAAGACAAAATTTAATACTTGGTCAGGGAAACGGATCAGATTAGCTCGAAAA
TCCAACAAGTGGAAGTTGAGAATAAGTCACAGGGTACCTGAAGCCAAGTTTCAGGAGGAA
CCATGGCTAAAGATTGTGACATGAAGGGGTTGGAATTTGCACTTACACCAGGAGAGAGTA
TAGCTCCAGATCCTTGAATGAGTTTTACGCCGGTATCACCACTTGACGGAGAAACAGAAT
GAAATGAGCTAGCTTGAACCAATTGT
Primers used for PCR AR10 - 8474, show primer details
   
Sequence Name 54-K118809-0022-164-F12C-AR10
GenBank Accession LN508636 [GenBank]
Sequencing primer gene specific primer, AR10: 5'-CATAACACCAAATTTTCATCTGGA-3'
Sequence (A. th genome BLAST matches underlined)
>54-K118809-0022-164-F12C-AR10
GATCAATAATCATCACACCTCTCTCTCTCTCTCTCTCTCTACTATACTATCTATCAAGTT
TTTCTGAAATTAGTAGCACTTATTTTCTTTGTTTATGTCGACAAATTAAGTAGAAATCGA
CATGAATTACCATCGATCAGCCTGCAGCTACTGCTTTAGCTCGAGGCTTCGTATCGAGCA
GTTGATGCAATTTGCTTGTAGAGTTAGAATCATTGTCTCCTTGGTTCTTGTTCTTATCTC
CAGCTCCTGAGTTCTTAACTCTAGACAACATATTTGCGGGGACTCTCTTTTCGGGTTCCG
AGCATTTCAGTTTGTCCTGCAACCCAAAAAGAACCGGCCATGTTACCAATTTATATTCAA
TTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAAT
ATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCC
   
Sequence Name 22-K118808-0022-164-F12C-8409
GenBank Accession LN496328 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>22-K118808-0022-164-F12C-8409
TTGAATATAAATTGGTAACATGGCCGGGTTCTTTTTGGGTTGCAGGACAAACTGAAATGC
TCGGAACCCGAAAAGAGAGTCCCCGCAAATATGTTGTCTAGAGTTAAGAACTCAGGAGCT
GGAGATAAGAACAAGAACCAAGGAGACAATGATTCTAACTCTACAAGCAAATTGCATCAA
CTGCTCGATACGAAGCCTCGAGCTAAAGCAGTAGCTGCAGGCTGATCGATGGTAATTCAT
GTCGATTTCTACTTAATTTGTCGACATAAACAAAGAAAATAAGTGCTACTAATTTCAGAA
AAACTTGATAGATAGTATAGTAGAGAGAGAGAGAGAGAGAGAGGTGTGATGATTATTGAT
CTATAAATTTTCGGAGAGAGAGAGGGAGAAAGAGAAACTTTTCCTCCAGATGAAAATTTG
NGTGTTAT

Last Updated on 23.10.2014 13:25