SimpleSearch - Line and FST details


Line specific information

 
Line ID 164F12
Vector Used pAC161
Line Availability only available from NASC (N415720)
Segregation Analysis 96:89:65
Confirmed for Hit At2g46270
Parent of DUPLO pair 2460
Parent of pair(s) none

Gene hit At2g46270

 
Sequence (A. th genome BLAST matches underlined)
>94-K013270-022-164-F12-8409
GTGATCCATGTAGAATTTCCCGTACATGAAGACCTTTACAATTGAATATAAATTGGTAAC
ACTGGCCGGTTCTTTTTGGGTTGCAGGACAGAGACTGAAATGCTGCGGAACCCGAAAAGA
GAGTCCCCGCAAATATGTTGCCTATGGGATCCTCCGTATAGTGATTGGGCTGCCAAGGCA
TACAGACTTCTGTTCAACCACCCAAACGTCAGAAAGCCTGACGACGGAGCAGCATTCCAA
AAAGATCCCTTGGCTCGTCTGGGTCGGCTATGGGATCCTCCCTATAGTGAGCANCCGGAC
CATGGTTATAGGATCCTCGCTATGGCGCACCTGCAT
GenBank Accession FR804828 [GenBank]
Graphic View Graphic view of gene At2g46270
Predicted Position of Insertion Chr2:19002694 - go to primer design
BLAST e Value 1e-22
Hit Clone Code (BAC ID) T3F17
Hit Gene Code At2g46270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation G-box binding factor 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL937906 [GenBank]


Last Updated on 07.07.2016 14:03