Sequences from confirmation amplicon


Confirmation sequences for line 165D10 and hit At5g62165 are shown.
Line ID 165D10
Locus At5g62165 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:24968434
Primers used for PCR CH03 - 8474, show primer details
   
Sequence Name 17-K020436-022-165-D10C-8409
GenBank Accession LN493676 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>17-K020436-022-165-D10C-8409
ATTTCCCGGACATGAAGCCATTTACAATTGAATACTCATTGCAGTTTCTATTTGGCAAAC
CGATGAATAAGTCAGTTTCAACTTCCAAATTCAAATCTATAACTTTGTATTTCTCTTGCT
GCTGATCAGTCGATGATCCTCTCCATGGATTAATAACATTCTGTCCATGACATAGATTGC
AATTTCATCAACCATAAAACATATCATTTTATAATTTTATCTCTAGGAGAAAATGTTAAA
AATGATATCCAAAAGTTGTAAACAAAACCAACTGAAAAAGTCAAACTCAAACTTAAATTT
TGAAATCCTTAAAACTAATCAAATACTTTATCAAAAAAAAAAAACTTGGAACGAGAACCA
AATTTTACCGAATAGCACCGTATAATCTCTAACAATGATTTTGCCGGAAAAAAAAAATCT
AAAAATGTAAAAAATCAACCGACGAAAAACAATCAAAGTTCTTTGGGTAATATTTTCAGC
ATACTAAAGCATTAGCAATTCATAACATATATGATATATATGTAAATTTCCGTTGAATTA
GTATTGGTATATACAATTCTAAATATGTGAATTGTAAA
   
Sequence Name 18-K020436-022-165-D10C-CH03
GenBank Accession LN494123 [GenBank]
Sequencing primer gene specific primer, CH03: 5'-GTTACATCAAAAGGTGACCCATCT-3'
Sequence (A. th genome BLAST matches underlined)
>18-K020436-022-165-D10C-CH03
CTCTTTACAATTCCATATTTAGAATTGTATATACCAATACTAATTCACACTGAAATTTAC
ATATATATCATATATGTTATGAATTGCTAATGCTTTAGTATGCTGAAAATATTACCCAAA
GAACTCTGATTGTTTTTCGTCGGTTGATTTTTTACATTTTTAGATTTTTTTTCTCCGGCA
AAATCATTGTTAGAGATTATACGGTGCTATTCGGTAAAATTTGGTTCTCGTTCCAAGTTT
TTTTTTTTTGATAAAGTATTTGATTAGTTTTAGGGATTTCAAAATTTAGGTTGGAGTTTG
ACTTTTTCGGTGGGTTTTGTTTCCACCTTTGGGATATCATTTTTACCATTTTCCCCTAGA
GATAAAATTATAAAAGGATTTGTTTTAGGGTTGATGAAATTGCAATCTATGTCAGGGACA
AAATGTTATTAATCCTGGGAGAGGATCTTCGACTGATCACCACCAAGAGAAATACAAGGT
TATAAATTTGAATTTGGAAGTTGAACCTGCTTTATTCTTCGGTTTGCCAAATAAAACCTG
CAATGAGTATTCAATTGTAAATGGTTTCTTGTCGCGGGAAATCTACTTGGATCACCAATG
AGTATGAGGGCCAATATGGAGAAAAAGAAAGAGTAATTCCCCTTTTTTTTTCAATTCAAA

Last Updated on 23.10.2014 13:25