SimpleSearch - Line and FST details


Line specific information

 
Line ID 165D10
Vector Used pAC161
Line Availability only available from NASC (N415790)
Segregation Analysis 100:51:41
Confirmed for Hit At5g62165
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g62165

 
Sequence (A. th genome BLAST matches underlined)
>76-K013365-022-165-D10-8409
GTGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATACTCATTGCAGTTC
CTATTTGGCAGAAGCTGATGAATAAGGGATATTCAACTTTCAAATGCAAATTCTATAACT
TTGTATCTTCTCTTGCTGCTGATCAGTCGATGATCCTCTCCATGGATTAATAACATTCTG
TCCATGACATAGATTGCAATTTCATCAACCATAAAACATATCATTTTATAATTTTATCCC
TATGGGATCCTCCCTAT
GenBank Accession AL759075 [GenBank]
Graphic View Graphic view of gene At5g62165
Predicted Position of Insertion Chr5:24968431 - go to primer design
BLAST e Value 3e-63
Hit Clone Code (BAC ID) MTG10
Hit Gene Code At5g62165 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 42
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03