Sequences from confirmation amplicon


Confirmation sequences for line 166E01 and hit At1g77130 are shown.
Line ID 166E01
Locus At1g77130 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:28980026
Primers used for PCR AK05 - 8474, show primer details
   
Sequence Name 27-K017121-022-166-E01C-AK05
GenBank Accession LN498161 [GenBank]
Sequencing primer gene specific primer, AK05: 5'-AATGTTGAATTAGATGGCTCAACC-3'
Sequence (A. th genome BLAST matches underlined)
>27-K017121-022-166-E01C-AK05
ACCATTAGACCAGAGTTGAAGAGCGTAGCATTGTTTCCAGTTGCTGATATCTCAGGGAAC
TCGAAGAGGAAATCAATGTTTCTCAGGATAAGCATGTCTGCATCGATGAAGATGATCTTA
CTGTATTCAGTCAGTTGCCAAAGACGAAACTTGCTGTAGTTCCATTCGTTGTAGGCATTT
GGTACAGCATTCGGGTTCCTGATTCTTTGAAACATTTGAATCTTCCATCCAGCAGCTACC
AAGCCACTTTTATGGTATTCGCTTATCGTTTCATCAACAAGTATGACCAGATCACGAGTA
GAGCCTGACATTCGAATGCTCTGTGCAGCTGCAATGGCTCCAATAAACACTGATAGTTTA
ATATATCCTCGTGCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACAT
GGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTT
TTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATA
AAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAAT
TCGGAAATCTTTATTTCGACGTGTCTACATT
   
Sequence Name 28-K017121-022-166-E01C-8409
GenBank Accession LN498631 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>28-K017121-022-166-E01C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGCACGAGGATATA
TTAAACTATCAGTGTTTATTGGAGCCATTGCAGCTGCACAGAGCATTCGAATGTCAGGCT
CTACTCGTGATCTGGTCATACTTGTTGATGAAACGATAAGCGAATACCATAAAAGTGGCT
TGGTAGCTGCTGGATGGAAGATTCAAATGTTTCAAAGAATCAGGAACCCGAATGCTGTAC
CAAATGCCTACAACGAATGGAACTACAGCAAGTTTCGTCTTTGGCAACTGACTGAATACA
GTAAGATCATCTTCATCGATGCAGACATGCTTATCCTGAGAAACATTGATTTCCTCTTCG
AGTTCCCTGAGATATCAGCAACTGGAAACAATGCTACGCTCTTCAACTCTGGTCTAATGG
TGGTTGAGCCATCTAATTCAACAT

Last Updated on 23.10.2014 13:25