SimpleSearch - Line and FST details


Line specific information

 
Line ID 166E01
Vector Used pAC161
Line Availability only available from NASC (N415889)
Segregation Analysis 100:100:97
Confirmed for Hit At1g77130
Parent of DUPLO pair 2668
Parent of pair(s) none

Gene hit At1g77130

Sequence (A. th genome BLAST matches underlined)
>05-K013366-022-166-E01-8409
GTACTGAGTATTCTAATGTCAGGCTCTACTCGTGATCTGGTCCTACTTGTTGATGAAACG
ATTAGCGAATACCATAAAAGTGGCTTGGGAGCTGCTGGATGGAAGATTCAAATGTTTCAA
AGAATCAGGAACCCGAATGCTGTACCAAATGCCTACAACTATTGTTACTACAGCAAGTTT
CGTCTTTGGCAACTGACTGAATACGGGAAGATCATCTTCATCGCCGCAGACATGCTTATC
CTGAGAAACATTGATTTCCTCTTCGAGTTCCCTGAGATAAAAACAACTGGAAACACTGCT
ACGCTCTTCAACTCTGGTCTAATGGGGGGTGAACCATCTAATTGCACATTTCCACGTGCT
AATGGATAACATTAATGAAGGTGTGGTCTTAACACGGGAGGAGACCAAGGGCACCTTAAC
G
GenBank Accession AL937907 [GenBank]
Graphic View Graphic view of gene At1g77130
Predicted Position of Insertion Chr1:28980064 - go to primer design
BLAST e Value 4e-152
Hit Clone Code (BAC ID) T14N5
Hit Gene Code At1g77130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plant glycogenin-like starch initiation protein 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Mortimer et al. 2015, gux3-2]

Gene hit At4g03040

 
Sequence (A. th genome BLAST matches underlined)
>05-K013361-022-166-E01-8409
GTGATCCATGTAGGATTTCCGGGACATGATTTACTTTTACATAGAATATTTACTGCACTG
CTTCATTTCTACGGTTGCGATATGAGTTACAATGCCCATGTTCTTTTTTAAGAGGTTTAT
AAAGAGTTGATGAATCTTACAAAATAACATCCTGGTATTGTAGGCACTTCACTTGGAGCA
ATGCCTCCTTGAGGGCTATTGCTTCTGCTTCTATGGGATCCTCCCTATAGTGAGNNNNNN
GenBank Accession AL759188 [GenBank]
Graphic View Graphic view of gene At4g03040
Predicted Position of Insertion Chr4:1343219 - go to primer design
BLAST e Value 8e-55
Hit Clone Code (BAC ID) T4I9
Hit Gene Code At4g03040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein
Insertion Classification 3' region
Confirmation Status unknown


Last Updated on 31.08.2016 09:40