Sequences from confirmation amplicon


Confirmation sequences for line 166H11 and hit At2g15300 are shown.
Line ID 166H11
Locus At2g15300 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:6651486
Primers used for PCR NK34 - 8474, show primer details
   
Sequence Name 16-K102588-0022-166-H11C-8409
GenBank Accession LN493384 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>16-K102588-0022-166-H11C-8409
GAGCATGTGCCGGCAACATCAAGGCCATAACATTCTCTTGGACTCCGCGTTTGAGCCTGT
AATTACAGATATGGGCCTTGATCGTATTATGACTTCGGCCCATTTACTCACGGACGGGCC
ATTGTCGAGCTTACAAGACCAACCACCAGAGTGGTCGACAAGCCAGAAGCCAAACCCCAA
ATGGGATGTATATTCATTTGGTGTTATACTCTTGGAACTTCTCACAGGCATAGTTTTTTC
GGTCGATCGAGATTTGGTTCGCGATTCTGAGACTGATGAGAAAAGTTGGTTCTTGAAGTT
GGTCGATGGGGAAATTAGGGTTGAGGTGGCTCACCGCGAGGATGAGGCGGTCGCATGCTT
GAAGTTAGGCTATGAATGTGTCTCCTCCTTGCCTCAAAAGCGACCGTCTATGAAGGAAGT
GGTGCAAGTGCTAGAGAAAATGTTTGTTTAGTTGTTTACTTTATTCTTAAAAAGATATCA
TATATTTGTTGCAATGTAAATGGATTACTTTGTGTCATTTGAATTGTTGTTCGTTTTTTT
CTTTTTGTTTCGGGATAAAAGTATCATGGTATCTTTTGTTAGAGCATATCTAAGAAGCGC
AGATATTGTCGCATGATAAGCCTGAAGTTACTAAATATACTCTCAAAGCCTACAAACCC
   
Sequence Name 16-K102589-0022-166-H11C-NK34
GenBank Accession LN493385 [GenBank]
Sequencing primer gene specific primer, NK34: 5'-TGGGTTTGTAGGCTTTGAGAGTAT-3'
Sequence (A. th genome BLAST matches underlined)
>16-K102589-0022-166-H11C-NK34
GCGACATATCTGCGCTTCTTAGATATGCTCTAACAAAAGATACCATGATACTTTTATCCC
GAAACAAAAAGAAAAAAACGAACAACAATTCAAATGACACAAAGTAATCCATTTACATTG
CAACAAATATATGATATCTTTTTAAGAATAAAGTAAACAACTAAACAAACATTTTCTCTA
GCACTTGCACCACTTCCTTCATAGACGGTCGCTTTTGAGGCAAGGAGGAGACACATTCAT
AGCCTAACTTCAAGCATGCGACCGCCTCATCCTCGCGGTGAGCCACCTCAACCCTAATTT
CCCCATCGACCAACTTCAAGAACCAACTTTTCTCATCAGTCTCAGAATCGCGAACCAAAT
CTCGATCGACCGAAAAAACTATGCCTGTGAGAAGTTCCAAGAGTATAACACCAAATGAAT
ATACATCCCATTTGGGGTTTGGCTTCTGGCTTGTCGACCACTCTGGTGGTTGGTCTTGTA
AGCTCGACAATGGCCCGTCCGTGAGTAAATGGGCCGAAGTCATAATACGATCAAGGCCCA
TATCTGTAATTACAGGCTCAAACTCGGAGTCCAAGAGAATGTTATTGGCCTTGATGTTGC
CGTGCACATGCTTCTTGTCGTGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAAT
ATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGC
AGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATT
TATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTA
CATTC
Primers used for PCR 58wt - 3144, show primer details
   
Sequence Name 71-K118656-0022-166-H11C-58wt
GenBank Accession LN512636 [GenBank]
Sequencing primer gene specific primer, 58wt: 5'-ATGGATAAGCAGAAGGTACGAAGA-3'
Sequence (A. th genome BLAST matches underlined)
>71-K118656-0022-166-H11C-58wt
CCCGTTGAGGCATTTGATCGAACAGGTGGTGGGCGAGTAAAACACAATACTGAAACTCAA
CTAGTGACAGTGGATGGAGAAACTCAGCTGGAGCTAGATACTCTACTAAAGGCATCAGCT
TACGTACTTGGAACCAACAGAAGCGACGGAATTGTGTATAAAGCGGTGTTAGAGAACGGT
GCGGCTTTTGCAGTGCGGCGGATTGGGGCGGAGAGTTGTCCGGCGGCGAAATTTAAGGAA
TTCGAAAAGGAGGTTCAGGGTATCGCTAAACTTCGTCACCCAAATCTCGTTAGGGTTCGT
GGCTTCGTTTGGGGGAAAGAAGAGAAGCTTCTCATCTCCGACTATGTCCCAAATGGAAAC
CTACCTCTATCCTCCATCTCCGGTAAGTTTCTACAAACGGCGTACGTTACTTAATATTTG
CTAGAATACGCACTACTAGTCAGCGCATGTTAGCCCATTGCTCTTAACAAACAAACTATT
TTACGAATCTTGATATTTTGACATTAATTTTGTTTGATATGAAAACAGCAAAATCAAGCT
CGTTTTCTCATAAACACTGATAGTTTAAACCGAAGGCGGGAAACGACAATCTGATCCCCG
GGTACCCTGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGTCTTGCGAAG
GATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATATCAC
   
Sequence Name 45-K118655-0022-166-H11C-35St
GenBank Accession LN505693 [GenBank]
Sequencing primer T-DNA primer, 35St: 5'-GTGGATTGATGTGATATCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>45-K118655-0022-166-H11C-35St
CCTTCGCAGACCCTTCCTCTATTAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCC
GGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTATGAGAAAACGA
GCTTGATTTTGCTGTTTTCATATCAAACAAAATTAATGTCAAAATATCAAGATTCGTAAA
ATAGTTTGTTTGTTAAGAGCAATGGGCTAACATGCGCTGACTAGTAGTGCGTATTCTAGC
AAATATTAAGTAACGTACGCCGTTTGTAGAAACTTACCGGAGATGGAGGATAGAGGTAGG
TTTCCATTTGGGACATAGTCGGAGATGAGAAGCTTCTCTTCTTTCCCCCAAACGAAGCCA
CGAACCCTAACGAGATTTGGGTGACGAAGTTTAGCGATACCCTGAACCTCCTTTTCGAAT
TCCTTAAATTTCGCCGCCGGACAACTCTCCGCCCCAATCCGCCGCACTGCAAAAGCCGCA
CCGTTCTCTAACACCGCTTTATACACAATTCCGTCGCTTCTGTTGGTTCCAAGTACGTAA
GCTGATGCCTTTAGTAGAGTATCTAGCTCCAGCTGAGTTTCTCCATCCACTGTCACTAGT
TGAGTTTCAGTATTGTGTTTTACTCGCCCACCACCTGTTCGATCAAATGCCTCAACGGGT
TTTTGGTTCTCTATGTCACTCTCGGATGACACCGACGTTGTTTCAACGTACCTTCGCCTT
ATCC

Last Updated on 23.10.2014 13:25