SimpleSearch - Line and FST details


Line specific information

 
Line ID 166H11
Vector Used pAC161
Line Availability only available from NASC (N415935)
Segregation Analysis 50:50:50
Confirmed for Hit At2g15300
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g15300

 
Sequence (A. th genome BLAST matches underlined)
>45-K118655-0022-166-H11C-35St
CCTTCGCAGACCCTTCCTCTATTAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCC
GGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTATGAGAAAACGA
GCTTGATTTTGCTGTTTTCATATCAAACAAAATTAATGTCAAAATATCAAGATTCGTAAA
ATAGTTTGTTTGTTAAGAGCAATGGGCTAACATGCGCTGACTAGTAGTGCGTATTCTAGC
AAATATTAAGTAACGTACGCCGTTTGTAGAAACTTACCGGAGATGGAGGATAGAGGTAGG
TTTCCATTTGGGACATAGTCGGAGATGAGAAGCTTCTCTTCTTTCCCCCAAACGAAGCCA
CGAACCCTAACGAGATTTGGGTGACGAAGTTTAGCGATACCCTGAACCTCCTTTTCGAAT
TCCTTAAATTTCGCCGCCGGACAACTCTCCGCCCCAATCCGCCGCACTGCAAAAGCCGCA
CCGTTCTCTAACACCGCTTTATACACAATTCCGTCGCTTCTGTTGGTTCCAAGTACGTAA
GCTGATGCCTTTAGTAGAGTATCTAGCTCCAGCTGAGTTTCTCCATCCACTGTCACTAGT
TGAGTTTCAGTATTGTGTTTTACTCGCCCACCACCTGTTCGATCAAATGCCTCAACGGGT
TTTTGGTTCTCTATGTCACTCTCGGATGACACCGACGTTGTTTCAACGTACCTTCGCCTT
ATCC
GenBank Accession HG968796 [GenBank]
Graphic View Graphic view of gene At2g15300
Predicted Position of Insertion Chr2:6651486 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F27O10
Hit Gene Code At2g15300 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03