Sequences from confirmation amplicon


Confirmation sequences for line 167C05 and hit At5g39570 are shown.
Line ID 167C05
Locus At5g39570 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:15845189
Primers used for PCR MZ75 - 8474, show primer details
   
Sequence Name 21-K025945-022-167-C05C-8409
GenBank Accession LN495512 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>21-K025945-022-167-C05C-8409
TCCCGGACATGAAGCCATTTACAATTGAAGCCATCTAAATCATGAATGATCATAAAACAA
TCACTAAAGATATAAACTTTGGATTACTCTACACTCTACAATATGATCACCAAAGGATTC
AACAAAATATTAATTTCTTCAACTTACATATTTCTTGCGGCCATAGCTCCCTTCCTCATC
ATCACCAGAACCAGAACGGTTCCTACGCTGCTCATCATCATCATCGTCATTGCCACGGCC
ATAGCTAGGCTGCTTCCTGTAACTCCCCTCTTCCTGTTCCTCAGACCTCCCATAACTAGG
TTTCCTGT
   
Sequence Name 22-K025945-022-167-C05C-MZ75
GenBank Accession LN495959 [GenBank]
Sequencing primer gene specific primer, MZ75: 5'-ACAGGAAACCTAGTTATGGGAGGT-3'
Sequence (A. th genome BLAST matches underlined)
>22-K025945-022-167-C05C-MZ75
GAACAGGACGAGGGGAGTTACAGGAAGCAGCCTAGCTATGGCCGTGGCAATGACGATGAT
GATGATGAGCAGCGTAGGAACCGTTCTGGTTCTGGTGATGATGAGGAAGGGAGCTATGGC
CGCAAGAAATATGTAAGTTGAAGAAATTAATATTTTGTTGAATCCTTTGGTGATCATATT
GTAGAGTGTAGAGTAATCCAAAGTTTATATCTTTAGTGATTGTTTTATGATCATTCATGA
TTTAGATGGCTTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATG
AGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAA
AATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATT
ACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTT
ATTTCGACGTGTCTACATTCAC

Last Updated on 07.07.2016 14:16