SimpleSearch - Line and FST details


Line specific information

 
Line ID 167C05
Vector Used pAC161
Line Availability only available from NASC (N415965)
Segregation Analysis 50:50:36
Confirmed for Hit At5g39570
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g39570

 
Sequence (A. th genome BLAST matches underlined)
>35-K013362-022-167-C05-8409
TGATCCATGTAGATTTCCCGGACATGAAGCACTTTACCTTGTGATAACCTCTTTGATTAG
GATACGTACATGTACACCGAACTGAAGATGTAACCAGTGGACATCACTACACTCTCCATA
TGACGCACCAAAGGATCCAACAGAGTATTAATTTCTTCAACTTACATATTTCTTGCGGCC
ATAGCTCCCTTCCTCATCATCACCAGAACCAGAACGGTTCCTACGCTGCTCATCATCATC
ATCGTCATTGCCACGGCCATAGCTATGGGACCCCCCGTAAATCCACTCTTCCTGGACCTC
AGACCTGCGATAACTAGGCTTCC
GenBank Accession AL759284 [GenBank]
Graphic View Graphic view of gene At5g39570
Predicted Position of Insertion Chr5:15845183 - go to primer design
BLAST e Value 8e-70
Hit Clone Code (BAC ID) MIJ24
Hit Gene Code At5g39570 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transmembrane protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g35680

 
Sequence (A. th genome BLAST matches underlined)
>35-K013367-022-167-C05-8409
GTGATCCATGTAGATTNTCCCGAACATGAAGCACTTTACCTGTGATATAATATTCTGTAA
AGGATACATACATGTCACACTGACAATGAAAATATTTCACACATAACAGTTAATAGGAAC
TCTCGCACTACCATCCCCTGACGACTATTGGTGGCGTAATATACGACTGACCCACGAACT
TTAACTCCTGTACGCCATGCTCATGACATAGCAGGTGCCGACCATAGCGTATCTATATTA
ACTTATACTGACCTCCGTGACCGTGAGGCATCTTCTTTATAGCCCACTATGGGATCCTCC
TAATAGTGATATCAGAAGTGGCGGTTCTTGTCCACCAATGACTTACTTATTTGTGAACAT
CCATTAATAAAAACAATGTTGCCTATGGGATAATACCTAAAGTGAACGACGCTAAATCAT
TGTTCGCCACAACTTGAGGATCTCCAATCCTA
GenBank Accession FR804875 [GenBank]
Graphic View Graphic view of gene At2g35680
Predicted Position of Insertion Chr2:14997003 - go to primer design
BLAST e Value 4e-07
Hit Clone Code (BAC ID) T20F21
Hit Gene Code At2g35680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phosphotyrosine protein phosphatases superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 31.08.2016 09:40