Sequences from confirmation amplicon


Confirmation sequences for line 173D06 and hit At3g47690 are shown.
Line ID 173D06
Locus At3g47690 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:17583343
Primers used for PCR SF01 - 8474, show primer details
   
Sequence Name 29-K024207-022-173-D06C-SF01
GenBank Accession LN499125 [GenBank]
Sequencing primer gene specific primer, SF01: 5'-CGTGGATCTCAAGATCTCTACTGA-3'
Sequence (A. th genome BLAST matches underlined)
>29-K024207-022-173-D06C-SF01
TTTTACTTCTCCAAGCTCCGGGATGTAGAGATACTCTGCCAAACTCCTGAGCTAGATGAT
CTTCCGGTAAACGTTTCCGTAGAGCCTGTTCTTTTTTTTTTTTTAAACCTGGTTAAAGGG
AACCTGGCAGGGTATACCCCCCAACTTCCCTATTTAGCTCCAAAAAAAGTTTTCCAATAG
TCTAAAACCAAAATTTATTTTACCGGCGGTTAAAAGTACACATACCGTTTTTAGAATTAA
GAGGAAGATAAAGAGCTCTTACCAAGGAACTCCTCAAAGCCCCCCCAAATTTCATCAGCG
ACCGCATTTTAGGTTTTTCACCAAAGGAACTCAACTTTATGAACAAAATTTTGTTGGAAT
CGGAAAAAAATGCTTCCCGGGAATGCAAATAGGGGTACCAGTGAAAAAAATACTGTATGC
AACCGATGCAAATGAATCTGCTTTAAAAAACGCTCAAAAGTACCTAAACCAGTCCCTAGG
ATTTGAAAATGATGAACCTGAAGGAAACGGAAAACAACTGGAAAAAAAAAAAACTCAAGC
CCGGGAAATATATTCAAT
   
Sequence Name 30-K024207-022-173-D06C-8409
GenBank Accession LN499561 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>30-K024207-022-173-D06C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATTTCCCGGGCTTGAGTCTTTT
CTTCTTCCAGTTGTTCTCCGTTTCCTTCAGCTTCATCATCTTCAACTCCTAGGGACTGGT
TTAGGTACTCTTGAGCGTCTTCTAATGCAGATTCATTTGCATCGGTTGCATACAGTATCT
TCTTCACTGCTACCACTATCTGCATTCCAGGGAAGCATATATATCAGATTCAAACAAAAT
TATGTTCATAAAGTTGAGTTCATATGATGAAAAACATAAAATGCGGTCGCTGATGAAATC
TGGTGGTGCTATGAGGAGTTCATTGGTAAGAGCTCTTTATCTTCCTCTTAATTCTAAGAA
CGGTATGTGTACTTATAACAGCCGGTAAACTAAATTCTGGTTCTAGACTATTGGAAAACT
TGTCTTGGAGCTAAATAGTGAAGTTGGTGGCTATACCATGCAAGGTACACTTAAACAAGA
TTAAAAAAAAAAAAAAAAACAGGCTCTACGGAAACGTTTACCGGAAAATCATCTAGCTCA
GGAGTTTGGCAAAGTATCTCTACATCCCGGAGCTTGGAAAAGTAAAAGTCTCTTTCTTTT
TCCAAAAAAT

Last Updated on 23.10.2014 13:25