SimpleSearch - Line and FST details


Line specific information

 
Line ID 173D06
Vector Used pAC161
Line Availability only available from NASC (N416554)
Segregation Analysis 50:50:49
Confirmed for Hit At3g47690
Parent of DUPLO pair 12836
Parent of pair(s) none

Gene hit At3g47690

 
Sequence (A. th genome BLAST matches underlined)
>44-K013470-022-173-D06-8409
GTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAAAAATTGTGATTAGT
GAGTGAGAAAGAGTAGGAAGACTCATATTAAACAACAAACTCTAAAATAATCCAAATTAG
CATTTTTCCTGTTATGATTGGTTATAATTTTTTTTTATAGTTTAAAATTTAATTAAACAA
TTTAATTACATTAAAAACACTAATAGTTAATTATATTAGTAAGAGACTCATAGAGAGGCT
ATGGGATCCTCCCTTTAGTGAGACAGAGCTGACTCTGTGGTAGGCGGCTATATTAACTTA
TGAGTCGTTGGGATACTACCAAACATGAGCAGAGCTGGTTAGTTCAATTCCCATTCAAAA
TACAAAGTTGTGTGTTATATCTTAATCCACAAATAAATGAAATGATCTCACCTATGAATG
TACCTTCGTATGACAGATTGATTTGCTGAACAATATCTAACTAAGAGAACACTGTACTCT
TCGCTACCTTCTTGGCTTCGGCTGCACTCAAATATCGAATTCTATTCTCACGTAGCCACT
TATCGCCTCTACTCAGACCGTCCTTCACTTGCTTCTCTTCCTCTCCAAAAACGTCCGCCC
CTGCCTTAGTCTACGAAAGAAAACTCCGGGTTTAACCCACC
GenBank Accession AL770640 [GenBank]
Graphic View Graphic view of gene At3g47690
Predicted Position of Insertion Chr3:17583371 - go to primer design
BLAST e Value 2e-119
Hit Clone Code (BAC ID) F1P2
Hit Gene Code At3g47690 [TAIR] [MIPS] [SIGnAL]
Gene Annotation microtubule end binding protein EB1A
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL770639 [GenBank]


Last Updated on 14.10.2014 10:23