Sequences from confirmation amplicon


Confirmation sequences for line 174E09 and hit At3g61890 are shown.
Line ID 174E09
Locus At3g61890 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:22915300
Primers used for PCR PH21 - 8474, show primer details
   
Sequence Name 37-K017464-022-174-E09C-PH21
GenBank Accession LN502436 [GenBank]
Sequencing primer gene specific primer, PH21: 5'-AAAAACCAATAAATGCCAAGACTG-3'
Sequence (A. th genome BLAST matches underlined)
>37-K017464-022-174-E09C-PH21
ATCATTATCAATTATTGTTTCTATCACTGTTCAATTAAAGATAAAGATATCGATAGAATC
ATTATGTACCTCAGAGACCAGAGATTGCTTTTCTTTCTTCATGATTTCAAATTGTGAAGC
CAAATTGTTGTAATTGGCTCTAAGAGTGTTATACTCTTTCTCAAGTTGCTTAGTTTTCCA
TCGAGCCCTCTTGTTTTGAAACCATATAGCCACTTGTCTTGGTTGCAGCCCTAGCTCTCT
AGCTACCTGAACCTTCTTCCTCGGCTCAAGCCTCGTCTCAGACTCAAATATAAGCTCAAG
TGACTTGATCTGTTCCTCGCTAAACCTCTTTTGGTTATTGCTCTTCTTCATCTTCTTCTT
ATTCATGGTCATGCCACTACTAATCTCGCTGAAACAGCAGTTGAAAAAATCTCCTTCTTC
CATGGTTTTCACCAGATCTTGTAAGTTTCTTGATTTTGATTAAGAGAGAAGGTTTTGGAA
TTATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTAT
GATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGT
AGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGAT
CCGTCGTATTTAT
   
Sequence Name 38-K017464-022-174-E09C-8409
GenBank Accession LN502815 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>38-K017464-022-174-E09C-8409
ATTGAATATAATTCCAAAACCTTCTCTCTTAATCAAAATCAAGAAACTTACAAGATCTGG
TGAAAACCATGGAAGAAGGAGATTTTTTCAACTGCTGTTTCAGCGAGATTAGTAGTGGCA
TGACCATGAATAAGAAGAAGATGAAGAAGAGCAATAACCAAAAGAGGTTTAGCGAGGAAC
AGATCAAGTCACTTGAGCTTATATTTGAGTCTGAGACGAGGCTTGAGCCGAGGAAGAAGG
TTCAGGTAGCTAGAGAGCTAGGGCTGCAACCAAGACAAGTGGCTATATGGTTTCAAAACA
AGAGGGCTCGATGGAAAACTAAGCAACTTGAGAAAGAGTATAACACTCTTAGAGCCAATT
ACAACAATTTGGCTTCACAATTTGAAATCATGAAGAAAGAAAAGCAATCTCTGGTCTCTG
AGGTACATAATGATTCTATCGATATCTTTATCTTTAATTGAACAGTGATAGAAACAATAA
TTGATAATGATCTTTTTTTTTTATAAAGTATAAAATAGCAAATACAGTCT

Last Updated on 23.10.2014 13:25