SimpleSearch - Line and FST details


Line specific information

 
Line ID 174E09
Vector Used pAC161
Line Availability only available from NASC (N416665)
Segregation Analysis 100:76:57
Confirmed for Hit At3g61890
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g61890

 
Sequence (A. th genome BLAST matches underlined)
>69-K013531-022-174-E09-8409
NTGATCCATGTAGATTNTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGCAATG
GAAAAAGACAAATTGCCCTATGGGATCCTCCCTATCGTGAAATATCCTGGGGGAATAGCT
ATGTGTGCTCGTGTAGGGCCTCAGATATATATTATGTTTTATCCTTGAATATTAAAATAT
TCAACAAAAACATTATCCACTCATTGACTAACAAGACCTGCATATATTGTGGTACCCTAG
TCTAAAAATATACGTCCAAACTTTGTGGCTCGACACAAATTGACTCATGTCTCTTTCAGT
TTAAGTCGTATTTCATTTAGATGTGAACTAATCATCTAACTACTGATAATATTTTCATAC
TTTTTTTCCTTTATAATATAAGTATTATCAGCTTTTATATGTTTCATGGAAGTGATCAAG
TGAATGATAACGTGGGTTGACAATCAAACGGGCGAACTGGCTTTGGTTACATCAATTAAT
CACCATACATATTTTACTTTTTAACAGTTTGGCCGTTCCTAAGAAAAATGAAGCAGTTTA
TAATGAAACAAAAAAAAAAACTCAATTTTTTGCCTTTCCTGGCCATAAAGGGCTTTTTTA
AAATTAAAATTAAC
GenBank Accession AL770760 [GenBank]
Graphic View Graphic view of gene At3g61890
Predicted Position of Insertion Chr3:22915316 - go to primer design
BLAST e Value 3e-165
Hit Clone Code (BAC ID) F21F14
Hit Gene Code At3g61890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox 12
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL770759 [GenBank]


Last Updated on 31.08.2016 09:40