Sequences from confirmation amplicon


Confirmation sequences for line 175F10 and hit At2g36350 are shown.
Line ID 175F10
Locus At2g36350 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:15240777
Primers used for PCR KP07 - 8474, show primer details
   
Sequence Name 40-K022405-022-175-F10C-8409
GenBank Accession LN503565 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>40-K022405-022-175-F10C-8409
TAGATTTCCCGGACATGAAGCCATTTACTTCAGATAATTTATCGTGTCTGGTGATGGAGT
ATTGTCCTGGTGGTGATCTTCATGTCCTAAGGCAGAAACAGCTCAGCAGGTGTTTCTCCG
AACCCGCAACTAGGTAAGATCACATTTCACATTGTTGTTATGAATTTGTAATGCTCACAA
AGTCTTTGTTGGTTAGAAAATTCAGTGGTAATAATATACAGTAAAATTGATGATATTGTT
GACAGGTTCTATGTAGCAGAAATCCTCCTTGCGCTGGAGTACTTACACATGCTTGGTGTT
ATATACCGAGATTTGAAACCAGAGAACATTCTAGTCCGAGAAGATGGTCACATCATGCTT
ACAGATTTTGACCTCTCACTCAGATGTGCGGTGAACCCGACTCTTCTCAGATCAACTTCT
CCACCCGAGAAAGATCCCGCAAGGATGTCCGGTCCATACAGCACATCGAATTGCATACAA
CCTCTATGTATTGAACCATCATGTCGGGTCCCATGTTTCAGCCCTAGGCTCTTATCAAC
   
Sequence Name 41-K022405-022-175-F10C-KP07
GenBank Accession LN503924 [GenBank]
Sequencing primer gene specific primer, KP07: 5'-GTTTCTTGCTTGGGTTGATAAGAG-3'
Sequence (A. th genome BLAST matches underlined)
>41-K022405-022-175-F10C-KP07
GGGCTGAAACATGGGACCCGACATGATGGTTCAATACATAGAGGTTGTATGCAATTCGAT
GTGCTGTATGGACCGGACATCCTTGCGGGATCTTTCTCGGGTGGAGAAGTTGATCTGAGA
AGAGTCGGGTTCACCGCACATCTGAGTGAGAGGTCAAAATCTGTAAGCATGATGTGACCA
TCTTCTCGGACTAGAATGTTCTCTGGTTTCAAATCTCGGTATATAACACCAAGCATGTGT
AAGTACTCCAGCGCAAGGAGGATTTCTGCTACATAGAACCTGTCAACAATATCATCAATT
TTACTGTATATTATTACCACTGAATTTTCTAACCAACAAAGACTTTGTGAGCATTACAAA
TTCATAACAACAATGTGAAATGTGATCTTACCTAGTTGCGGGTTCGGAGAAACACCTGCT
GAGCTGTTTCTGCCTTAGGACATGAAGATCACCACCAGGACAATACTCCATCACCAGACA
CGATAAATTATCTGAAGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGA
GTATGAGGTCAATATGGAGAAAAAGAAGAGTAATTCCATTTTTTTCATNCAAAAATGTAG
ATGT

Last Updated on 23.10.2014 13:25