SimpleSearch - Line and FST details


Line specific information

 
Line ID 175F10
Vector Used pAC161
Line Availability available as T3 set from NASC (N416774)
Segregation Analysis 100:61:38
Confirmed for Hit At2g36350
Parent of DUPLO pair 12781
Parent of pair(s) none

Gene hit At2g36350

 
Sequence (A. th genome BLAST matches underlined) 
>78-K013532-022-175-F10-8409
NTGATCCATGTAGATTTCCCGGACATGAACGCCTTTACTATAGATATATATATCTGTGTC
TGGTCGATGGAGTATTGTCCTGGTAGGAGATCTTCATGTCCTAAGGCAGAAACAGCTCAG
CAGGTGTTTCTCCGAACCCGCAACTATGGGATCCT
GenBank Accession AL770900 [GenBank]
Graphic View Graphic view of gene At2g36350
Predicted Position of Insertion Chr2:15240798 - go to primer design
BLAST e Value 4e-32
Hit Clone Code (BAC ID) F2H17
Hit Gene Code At2g36350 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL770900 [GenBank]


Last Updated on 10.06.2021 13:37