Sequences from confirmation amplicon


Confirmation sequences for line 176A06 and hit At5g39050 are shown.
Line ID 176A06
Locus At5g39050 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:15635778
Primers used for PCR ZZ86 - 8474, show primer details
   
Sequence Name 29-K023373-022-176-A06C-8409
GenBank Accession LN499117 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>29-K023373-022-176-A06C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGTTGCCGGGAACACAGG
TTTTGTCTGTTGCCGGGTCGACCCGGTTCGGAGTTTACGGGTTGGATTTTGGGTGGGGTA
GACCGGAGAAAGTGGTGGTTGTGTCAATTGACCAAGGTGAAGCGATTTCTTTTGCGGAGA
GTAGAGATGGGAGTGGTGGTGTAGAGCTTGGCTTCTCCCTCAAGAAACATGAAATGGATG
TTCTTGTTGATTTGCTTCACAAGGGACTAGAAAATTAAATCATTTTTTTCTTTCTTCAGA
AGAGTAAAATAATATAAGAAATAAAATTTATTGTGGAAAATTGTAGCTTTCTATTGTCAA
ATAAATCTAGTTTAGAGTTCCAGCTTCACCAGGAAACTCAATCTTTGAACCACATATAAC
CTCACTATGCGTTAAATTGGATCTTAAGTTAAACTTATATTTCTCAAGAATACGATATGT
AGTATTGCTTTTAGAAGTGTCAATTGGGCTGTCCAAAGCCCATTGGTCATGTCCACTTGG
ATCATTTTTTTCATGGGTTTTATTGGTTGGTCTTTAATGGACAATGGTTTGAAAATTTGT
CCAAGACCATTAAAGACCATTGTCCAATGGTCAGCCCATGGTCAGCCCATGGCCAGCCCA
TA
   
Sequence Name 30-K023373-022-176-A06C-ZZ86
GenBank Accession LN499554 [GenBank]
Sequencing primer gene specific primer, ZZ86: 5'-TATAAACATCATTGTATGGGCTGG-3'
Sequence (A. th genome BLAST matches underlined)
>30-K023373-022-176-A06C-ZZ86
TGGGCTGACCATGGGCTGACCATTGGACAATGGTCTTTAATGGTCTTGGACAAATTTTCA
AACCATTGTCCATTAAAGACCAACCAATAAAACCCATGAAAAAAATGATCCAAGTGGACA
TGACCAATGGGCTTTGGACAGCCCAATTGACACTTCTAAAAGCAATACTACATATCGTAT
TCTTGAGAAATATAAGTTTAACTTAAGATCCAATTTAACGCATAGTGAGGTTATATGTGG
TTCAAAGATTGAGTTTCCTGGTGAAGCTGGAACTCTAAACTAGATTTATTTGACAATAGA
AAGCTACAATTTTCCACAATAAATTTTATTTCTTATATTATTTTACTCTTCTGAAGAAAG
AAAAAAATGATTTAATTTTCTAGTCCCTTGTGAAGCAAATCAACAAGAACATCCATTTCA
TGTTTCTTGAGGGAGAAGCCAAGCTCTACACCACCACTCCCATCTCTACTCTCCGCAAAA
GAAATCGCTTCACCTTGGTCAATTGACACAACCACCACTTTCTCCGGTCTACCCCACCCA
AAATCCAACCCGTAAACTCCGAACCGGGTCGACCCGGCAACAGACAAAACCTGTGTTCCC
GGCAACAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGC
AATGAGTATGAATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAAT
TCAAAAATG

Last Updated on 23.10.2014 13:25