SimpleSearch - Line and FST details


Line specific information

 
Line ID 176A06
Vector Used pAC161
Line Availability only available from NASC (N416806)
Segregation Analysis 50:33:28
Confirmed for Hit At5g39050
Parent of DUPLO pair none
Parent of pair(s) 4586, 4663, 7338, 8492, 10044, 93041, 93043, 93046, 93047, 93048, 93049, 93050, 93051

Gene hit MGI19

 
Sequence (A. th genome BLAST matches underlined)
>41-K013533-022-176-A06-8409
NTTTGATCCATGTAGATTTCCCTGGACTGAAAGCCTTTACAATTGAATATATCCTGTAGA
TTTCTCGGGCGTAAGAGTTGTTACTACACATTCTCTCCCCAATATTTAAGATCATCAATA
TTACGTGACAAAAACCAGGAGACTTGTTATTCTGTGAGACTTGACTCTTCTGCAGAATCA
TTTTCTGCTCTTTCCTTCTGAAGAAACTTATGGCACATGATGGCACCAACAAAATCAAGC
ATTCCATGTTTCACAAGCTCCAGCCGCTCCGAACTGTTCATTACAGAGAACCCAAACCGC
TCAGTCCAAGTGGTCACAACCTCTTTTGCAGCCGGTAAGACCAGTCTACAAACTCCCATC
TGAGACATTTGCTTCTCCAACTCATCCATCAGCACTCTGCACATCCCACTTCTTCTGTAA
CTAGACAATGTCGCCACCAAAGGGATCTCGACTACATCTTTGTCAACTCTCACTGCTGCC
ACCGTGATAGGCCTCGCTCTTTCTCTCGATCAAGACTGTGTAAAACCCGCGGCCCACTCC
AGTTCTGTCTTTCCTGTATATCAGGCCCCTAACAAGGTCTCTCCCAGAGCAAACATCATT
GGTACGCTCAAACCCTTGGTGAAGTATCTTGCCAGCAGATTTTAACTTGGAGATTGGTTC
ATCATCATAGGGTTCACCTTGGTTGGGAGCCTCTCATAAATGCCCAGACCAAATTACCGG
GGGTGCCTACTGCAATTTTACTCCCTA
GenBank Accession AL770940 [GenBank]
Graphic View Graphic view of sequence AL770940 of line 176A06
Predicted Position of Insertion Chr5:25570461 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MGI19
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At5g39050

 
Sequence (A. th genome BLAST matches underlined)
>41-K013518-022-176-A06-8409
NTGATCCATTGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGTTGCC
GGGAACACAGGTTTTGTCTGTTGCCGGGTCGACCCGGTTCGGAGTTTACGGGTTGGATTT
TGGGTGGGGTAGACCGGAGAAAGTGGTGGTTGTGTCAATTAGACCAAGGTGAAGCGATTT
CTTTTGCGGAGAGTAGAGATGGGAGTGGTGGTGTAGAGCTTGACTTCTCCCTCAAAAAAC
ATGAAATGGATGTTCTTGATGATTTGCTTCACAAGGGGCTATGAGTATCCTACCTTCAGN
GCCGTNTCATCCCAAGAGGACACAACCTCTTTAGCTACCTGTATTACGGGGCTATCGACT
CCCATCTGAGACATTTGCTTCTCCGGATCCTCCATATCCACTCTGCACATNCCACTTCTT
CTGTA
GenBank Accession AL770939 [GenBank]
Graphic View Graphic view of gene At5g39050
Predicted Position of Insertion Chr5:15635775 - go to primer design
BLAST e Value 9e-107
Hit Clone Code (BAC ID) MXF12
Hit Gene Code At5g39050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation HXXXD-type acyl-transferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40