Sequences from confirmation amplicon


Confirmation sequences for line 176E02 and hit At3g20880 are shown.
Line ID 176E02
Locus At3g20880 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:7313612
Primers used for PCR PE56 - 8474, show primer details
   
Sequence Name 59-K022563-022-176-E02C-8409
GenBank Accession LN509869 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>59-K022563-022-176-E02C-8409
ATTTCCCGGACATGAAGCCATTTACAATTCAATTAAATTGGTAATTAAAAAAGTTTTTAG
AATGTGTCTTATTTGATATAATTACTAAATTTGATTTGCATGTTATCAAATATCAATCTA
ACAATCTTTATTCCGAGTTCTATTCCTACACGTATAAGGGACACATTTCCATGAGTACAC
TAGAATTTAGAGTAGAGTAAATTAGAGAATAGAGAACTTTGGTGAAAATATACCAAAATT
TTAGTATCTTGAAGTATAATCCTATTTACCAAAATTTTGGAAAGCAGTCTTTTTAGTAAT
ATAAATTACGTAGATATCTAAAGAAAATCATAAAGAAGAGAAAAAAGAGAGAGTTGTATT
CTCTACGAGTGTTTGAATTGCAAGTAATAAGAGTCTACTACTAGGCTTTCTCAACAGTAA
TAGGTCTAGAAGGATGCTTATTTCATCGAGTTTATGAATTCTGAATTTTGTGATCATTGA
CAATACATATACATCTCATTTTTACAAGATCTCAT
   
Sequence Name 60-K022563-022-176-E02C-PE56
GenBank Accession LN510137 [GenBank]
Sequencing primer gene specific primer, PE56: 5'-CGAGCTTGATCATGAGATCTTGTA-3'
Sequence (A. th genome BLAST matches underlined)
>60-K022563-022-176-E02C-PE56
AATGAGATGTATATGTATTGTCAATGATCACAAAATTCAGAATTCATAAACTCGATGAAA
TAAGCATCCTTCTAGACCTATTACTGTTGAGAAAGCCTAGTAGTAGACTCTTATTACTTG
CAATTCAAACACTCGTAGAGAATACAACTCTCTCTTTTTTCTCTTCTTTATGATTTTCTT
TAGATATCTACGTAATTTATATTACTAAAAAGACTGCTTTCCAAAATTTTGGTAAATAGG
ATTATACTTCAAGATACTAAAATTTTGGTATATTTTCACCAAAGTTCTCTATTCTCTAAT
TTACTCTACTCTAAATTCTAGTGTACTCATGGAAATGTGTCCCTTATACGTGTAGGAATA
GAACTCGGAATAAAGATTGTTAGATTGATATTTGATAACATGCAAATCAAATTTAGTAAT
TATATCAAATAAGACACATTCTAAAAACTTTTTTAATTACCAATTTAATTGAATTGTAAA
TGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGA
AAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTA
TTATAAAATGAAAGTACATTTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGG
CGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTAC
Primers used for PCR PE57 - 8474, show primer details
   
Sequence Name 03-K022564-022-176-E02C-8409
GenBank Accession LN487301 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>03-K022564-022-176-E02C-8409
TCCCGGACATGAAGCCATTTACAATTGAATATATCTTTCTTTCTTTTATTAATTATATCA
ATTAATACAGTAAATTTAAAGCTTCTGCTATTCCCATTAATAATTATACTAATCCCTAAA
AAAAGCAAAGACGACGAAGAAGAAATCACAAGCATAAAGCATACAATTAATTAATGCTCG
AAACAACAACAACACTAAACACGATCATTCTTGCTGCTCGACATCAGAAGCAGCCTCCTC
TTCCTCATGATCAATTCCACAACAAGGGACATGACCATTCCCAAAGGCCTTAACGTGGTC
TTTAAGTGACCTCTTGTGCTTAAAATCCGACCCACATGAGCAATACCATAGCTTCCCACA
GTTCTTCTCGTGAGTCCTCCAATCTCCTTTGACCGCAAATGCCTTCCCACACCTACGACA
AGCAAAGGGCCTCACACCGTGCTTCCGCTTGTAATGTGTCTGAAG
   
Sequence Name 04-K022564-022-176-E02C-PE57
GenBank Accession LN487743 [GenBank]
Sequencing primer gene specific primer, PE57: 5'-CATGGTTCACAATACAGAAAAGGA-3'
Sequence (A. th genome BLAST matches underlined)
>04-K022564-022-176-E02C-PE57
GAGGGACACAACCAACGGCGATGCTGAAGCTGCCTTGCTACTGCTGTGCACCGGGCTGCA
AGAACAACATAGACCACCCAAGGGCTAGGCCGCTCAAGGACTTCCGTACGCTTCAGACAC
ATTACAAGCGGAAGCACGGTGTGAGGCCCTTTGCTTGTCGTAGGTGTGGGAAGGCATTTG
CGGTCAAAGGAGATTGGAGGACTCACGAGAAGAACTGTGGGAAGCTATGGTATTGCTCAT
GTGGGTCGGATTTTAAGCACAAGAGGTCACTTAAAGACCACGTTAAGGCCTTTGGGAATG
GACATGTCCCTTGGTGTGGAATTGATCATGAGGAAGAGGACGCTGCTTCTGATGTCGAGC
AGCAAGAATGATCGTGTTTAGTGTTGTTGTTGTTTCGAGCATTAATTAATTGTATGCTTT
ATGCTTGTGATTTCTTCTTCGTCGTCTTTGCTTTTTTTAGGGATTAGTATAATTATTAAT
GGGAATAGCAGAAGCTTTAAATTTACTGTATTAATTGATATAATTAATAAAAGAAAGAAA
GATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTA
TGATGGTCAATATGGAGAAAAAGAAAGAGTACTTACCAATTTTTTTTCAATTCAAAAAT

Last Updated on 23.10.2014 13:25