SimpleSearch - Line and FST details


Line specific information

 
Line ID 176E02
Vector Used pAC161
Line Availability only available from NASC (N416850)
Segregation Analysis 100:99:72
Confirmed for Hit At3g20880
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g20880

 
Sequence (A. th genome BLAST matches underlined)
>13-K013533-022-176-E02-8409
CTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCTGGCTTTC
TTTATGTAATTATAATAGTGAATACTGTGAATTAAAAGCTTCTGCTGTTCCGATTGATAA
TAATACTAATCCCATACAAAAAAGCATAGACGAGCTATAAAGATACCACAAGCATGGACC
ACTATCTATCTATGAAACGCTCGAAACAACAACAACACTAAACACGATCATTCTTGCTGC
TCGACATCAGAAGCAGCCTCCTCTTCCTCATGATCAATTCCACAACAAGGGACATGACCA
TTCCCAAAGGCCTTAACGTGGTCTTTAAGTGACCTCTTGTGCTTAAAATCCGACCCACAT
GAGCAATACCATAGCTTCCCACAGTTCTTCTCGTGAGTCCTCCAATCTCCTTTGACCGCA
AATGCCTTCCCACACCTACGACAAGCAAAGGGCCTCACACCGTGCTTCCGCTTGTAATGT
GTCTGAAGCGTACGGAAGTCCTTGAGCGGCCTATGGGATCCTC
GenBank Accession AL770991 [GenBank]
Graphic View Graphic view of gene At3g20880
Predicted Position of Insertion Chr3:7313590 - go to primer design
BLAST e Value 8e-178
Hit Clone Code (BAC ID) MOE17
Hit Gene Code At3g20880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WIP domain protein 4
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL770990 [GenBank]


Last Updated on 31.08.2016 09:40