Sequences from confirmation amplicon


Confirmation sequences for line 177F07 and hit At3g02730 are shown.
Line ID 177F07
Locus At3g02730 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:589969
Primers used for PCR PG02 - 8474, show primer details
   
Sequence Name 35-K017448-022-177-F07C-PG02
GenBank Accession LN501629 [GenBank]
Sequencing primer gene specific primer, PG02: 5'-AAGCCACGGAAACTTTGATTAGTA-3'
Sequence (A. th genome BLAST matches underlined)
>35-K017448-022-177-F07C-pg2
AATTCAAATCAATTGGTAATCTAAGCATTCGACATCGCAACGCCATTGATTTCATCGATT
CCGCTATATACAATCAGAGATGTCGAATGGTAAAAATTTCAAAGCAGAGAGAGGCATAGA
AGAGATAGTAGGTACCATTGAGTGTACATGTCAAGTACGACAAGCTTTTCACCGGCGGCT
TTAACGATGGGCCAGAACGTGTCCTTATCGACCTCCGTCACCTGACCAACACTGACATTA
ACGGTTTCTAAGCTACACCTAACAACAGAGGAATCTCCTCTTTTCCTAGAATCCAAAGAA
CAGAAACCAATCTTCGTCGTCGGGACGCCGGAGTAAGGAATCCGGCACTGTTTCCTCGAT
GGACCAAATCCTCCGGTAGTCGGAGATAAAGCCGTCGGCGAAGGAGAAAGACGGAGAGAA
AGAGGCATTGTTTGAGGAATTCAACAGAGAGACGATGACGAAGACGATGAAGCAAAATTT
CGAAAAGTTGAATGATCAGAGAGAGAGTGTGTGTGAGGTCTCAACGGACTGAGCAAATAT
TTATTTTATGTTAATTGGATTTTAAAGAGAAAAAGACGGTATTATCCTCGAATTGCTTCG
GATGAACAAGGATATTCGGGGGTACTTACTGTAATTATTTGTTTTCGT
   
Sequence Name 36-K017448-022-177-F07C-8409
GenBank Accession LN502034 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>36-K017448-022-177-F07C-8409
CCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATGTATTTTGTATTTTAGTCT
AAAATAGTTAAATTTATGGAAAATAAAAGAATTCATGTTTGTCTCATCATTTTGAGGGAC
CGAACCGTAATTTCGCAGTAAGAAACATAAATATCAATCTTAATTCCTCAAGAATTCTAC
ACCTCCCGTTCCATCTATCACGAAAACAAATAATTACAGTAAGTACCCCCGAATATCCTT
GTTCATCCGAAGCAATTCGAGGATAATACCGTCTTTTTCTCTTTAAAATCCAATTAACAT
AAAATAAATATTTGCTCAGTCCGTTGAGACCTCACACACACTCTCTCTCTGATCATTCAA
CTTTTCGAAATTTTGCTTCATCGTCTTCGTCATCGTCTCTCTGTTGAATTCCTCAAACAA
TGCCTCTTTCTCTCCGTCTTTCTCCTTCGCCGACGGCTTTATCTCCGACTACCGGAGGAT
TTGGTCCATCGAGGAAACAGTGCCGGATTCCTTACTCCGGCGTCCCGACGACGAAGATTG
GTTTCTGTTCTTTGGATTCTAGGAAAAGAGGAGATTCCTCTGTTGTTAGGTGTAGCTTAG
AAACCGTTAATGTCAGTGTTGGTCAGGTGACGGAGGTCGATAAGGACACGTTCTGGCCCA
TCGTTAAAGCCGCCGGTGAAAAGCTTGTCGTACTTGACATGTACACTCAATGGTACCTAC
TATCTCTTCTATGCCTCTCTCTGCTTTGAAATTTTTACCATTCGACATCTCTGATTGTAT
ATAGCGGAATCGATGAAATCAATGGCGTTGCGA

Last Updated on 07.07.2016 14:16