SimpleSearch - Line and FST details


Line specific information

 
Line ID 177F07
Vector Used pAC161
Line Availability only available from NASC (N416963)
Segregation Analysis 100:93:63
Confirmed for Hit At3g02730
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g02730

 
Sequence (A. th genome BLAST matches underlined)
>54-K013519-022-177-F07-8409
CTGATCCATGTAGAATTTCCCGNGACATGAAGCCTTTACAATTGAATATATCCTGATATA
CTTGGCGGCATGACCTAAAACACCAGAGCGGGCCTGCAGTACTATGCTCTCGAAAAGGCC
GAGAACAGGGACATGACCACCAACTGTCCGTACTGATCCCAGCCAGCATGCACCAACTTG
TTATTGCATAACATTACCGGCACAAAGGACTACCGTCCGGACCTGGACACGATGCTTAGA
CCACATAACCGATGGCGATTTTGAAGACATGACCAGGCTATGGTATCCTGCCTATGGGAA
GCTCCTTAAGNGAGANNNGCTCANTCCGGNGAGACCTCACACACACTGTCTCTCTGATCA
TTCAACTTTTCGAAATTTTGCTTCATCGTCTTCGTCATCGTGTCTCTGTTGAATTCCTCA
AACAATGCACTCTTTCTCTCCGTCTTTCTCCTTCGCCGACGGCTTTATCTCCGACTACCG
GAGGATTTGGGCCATCGAGGAAACAGTGCCGGATTCCTTACTCCGGCGTCCCGACGACGA
AGAT
GenBank Accession BX285295 [GenBank]
Graphic View Graphic view of gene At3g02730
Predicted Position of Insertion Chr3:589957 - go to primer design
BLAST e Value 9e-107
Hit Clone Code (BAC ID) F13E7
Hit Gene Code At3g02730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation thioredoxin F-type 1
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03