Sequences from confirmation amplicon


Confirmation sequences for line 179G11 and hit At5g61840 are shown.
Line ID 179G11
Locus At5g61840 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:24840160
Primers used for PCR SS11 - 8474, show primer details
   
Sequence Name 01-K027486-022-179-G11C-8409
GenBank Accession LN486433 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>01-K027486-022-179-G11C-8409
TACATTGAAAAAACTCCTCGATCCATCTTCGTTTATTTCAGAGGATTGTTTTATGATGTG
GGAAATGACCCTGAGGGTGGTTATTATGCGAGGTAATTTTTTTCTTATGAAAGTTCTTAG
CTATTGTTCATAATAAATTTCATAAATCTCCTAAAACAGTTCATAATTGCTTTATCGGTT
TGGAATTTTGGACATAAAACTCAAAAAAGGAAAATTTATCAGACTGTTTTTAGAGCCATG
GATTGTTCTTATAATCAGTGATGATGTTTGTTTGTCAAACTGGCACAGGGGTGCAAGAGC
AGCTGTATGGGAAAACTTCAAAGACAATCCGCTGTTTGACATCTCAACAGAGCACCCAAC
AACATATTAATGAGGACATGCAGAGAGCAATCTTCTGCCTATGCCCACTTGGATGGGCCC
CATGGAGTCCAAGACTGGTGGAAGCAGTGATATTCGGTTGCATCCCTGTGATCATAGCAG
ACGACATCGTGTTACCTTTTGCAGATGCAATCCCTTGGGAAGATAT
   
Sequence Name 02-K027486-022-179-G11C-SS11
GenBank Accession LN486892 [GenBank]
Sequencing primer gene specific primer, SS11: 5'-TCATCCACAAACACACCAATATCT-3'
Sequence (A. th genome BLAST matches underlined)
>02-K027486-022-179-G11C-SS11
GTACACGATGTCGTCTGCTATGATCACAGGGATGCAACCGAATATCACTGCTTCCACCAG
TCTTGGACTCCATGGGGCCCATCCAAGTGGGCATAGGCAGAAGATTGCTCTCTGCATGTC
CTCATAATATGTTGTTGGGTGCTCTGTTGAGATGTCAAACAGCGGATTGTCTTTGAAGTT
TTCCCATACAGCTGCTCTTGCACCCCTGTGCCAGTTTGACAAACAAACATCATCACTGAT
TATAAGAACAATCCATGGCTCTAAAAACAGTCTGATAAATTTTCCTTTTTTGAGTTTTAT
GTCCAAAATTCCAAACCGATAAAGCAATTATGAACTGTTTTAGGAGATTTATGAAATTTA
TTATGAACAATAGCTAAGAACTTTCATAAGAAAAAAATTACCTCGCATAATAACCACCCT
CAGGGTCATTTCCCACATCATAAAACAATCCTCTGAAATAAACGAAGATGGATCGAGGAG
TTTTTTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATG
ATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTA
GATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATC
CGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCG
ACGTGTCTA

Last Updated on 23.10.2014 13:25