SimpleSearch - Line and FST details


Line specific information

 
Line ID 179G11
Vector Used pAC161
Line Availability only available from NASC (N417171)
Segregation Analysis 100:93:71
Confirmed for Hit At5g61840
Parent of DUPLO pair 2351
Parent of pair(s) none
Note Although the line exists, the insertion in At1g22990 can not be ordered because the confirmation of this insertion failed.
Although the line exists, the insertion in At2g36500 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g22990

 
Sequence (A. th genome BLAST matches underlined)
>87-K013563-022-179-G11-8409
NTGATCCATGATAGATTTCCCGGACATGAAGCACTTTACAATTGAAGACTAGATAATCGC
TTGCCCTAGCTAGTACAAAGCGCGAGTAGGCTGTAATTGACTACGTGGAACTTGAGAGTT
GAAGATCGAACCTTTGATGGAGGAAACAGCGTTCTTGATTTTGCGTTCGCATCCGTCACA
GTCGATCTTCACCTTAATATTCACCGTCTGTTTATTAGCAAAATTTTGAAAAGGTTAAGC
AACTAAGAAACGACGAAACAACAACTAAACGGCTGCGTTTAGAGATTTTAGTTACCTGCA
TGACTTTACGTTTCTTCCGTTTTCGTATTGAGACGTAGAAATGGTTAGAGAAATACTCAG
AAAGATAATTGAGAGCTCCCATGTTTACTGTCACAAGCGAGCAGAGAGATGGAGAGGGAG
AGGGAGAGGGAGAGAGCTATGGGATC
GenBank Accession CT026157 [GenBank]
Graphic View Graphic view of gene At1g22990
Predicted Position of Insertion Chr1:8139543 - go to primer design
BLAST e Value 2e-172
Hit Clone Code (BAC ID) F19G10
Hit Gene Code At1g22990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Heavy metal transport/detoxification superfamily protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 066F04

Gene hit At2g36500

 
Sequence (A. th genome BLAST matches underlined)
>87-K104551-0022-179-G11-8409
ACACATTATTCCGGTTCGGAAACCTTAATTTCGACGTGTCTACATTTACCTCCAAATGGG
AGGGAACCACTGTCTTTGATGCGATGTCCAAGGATGGCTACTGTTGGATTCCTCCCTATA
GGAAGTAGCAATTCCTGCAGGAGCGACAGTAAATCAGGGGGTATGATATCTGATGTCCCC
GCCCGATTTCTTAGAAGCTAATATGGGTGTTGATATAATATCTATGTTTATACCTCCGAC
CATTTATCTTTTTATATAGCAAATTTATGTTAGTATGACTAATCGGTAAGTGTTTGATAA
TTGAGGACGCGAAGGTATTACCGATGTATTTACTGTCTATAGTTACTCTATAAATATTTG
TGTCCCAACTGCCATATTTTTAGATAGTGTAATCTAGCGGAGTGGTATTTTATGAATGCG
TTTGTATGGTATTGTAATTTCTGTTTAGTCTTCACATATTTGTGTTAGATATTAATGTAA
AGTTATGTTTTGCGATTATGAAAAAGTGATAAATTTTGCGCAATAGGCTGTGTATTCTGA
CGGATGGATAATAATTAGTTGTTGTTCCATTTATTTGGTCCTACGACTTTTGTTTTCATT
ATTATTTATCTTTTTATACTTATCTCTATCTGCCGAGGAATATATGTTAGTCACGTATAA
TATAGCATGGACTGTAATCAATGTGTTTTGTTGATTTCTATTATAGAAGTATATTGTTAT
ATCGTATGTGTCTTCGATAATATAGACATAGTTTCTTTTAATG
GenBank Accession FR805231 [GenBank]
Graphic View Graphic view of gene At2g36500
Predicted Position of Insertion Chr2:15318526 - go to primer design
BLAST e Value 6e-04
Hit Clone Code (BAC ID) F1O11
Hit Gene Code At2g36500 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 179G12

Gene hit At3g51260

 
Sequence (A. th genome BLAST matches underlined)
>72-K020161-022-179-G11t-8409
CTGTATTCTCCCCCGATGGTTCACCATCTTCCAAGTAGAGATAGTGCCCTATGGGCATCC
TCCCTATAGTGAGATGCGAGGTAATTTTTTTCTTATGAAAGTTCCTATGGGATCCTCCCT
ATAGAGAGANTCCCCTACCTCCACGATTCCATGTATTGTTCCTATCTCTACCGATACGGA
ATGCTTACTCCGGATTTGATCCTTTTTCTTATGGTTCTGCACTCCGATTTTGGTTCTAAT
CTTCACCTGTATAGCTCGCTTGATTTACTCAATCGCTACTTGTATAATCACTGTTTCAAT
CCTTCTGAACTACATCCTGATGTTGGAATTTTCTATCACTTCCCAATTGCAAACCTATGG
GATCCTCCCAATACTGAGTTCTGCCTATGCCCACTAGGATATCCCCCCTATAGTGAGAAA
CGGGTGGAGACANTGATATTCTGTTGCATCCC
GenBank Accession BX530807 [GenBank]
Graphic View Graphic view of gene At3g51260
Predicted Position of Insertion Chr3:19031107 - go to primer design
BLAST e Value 4e-52
Hit Clone Code (BAC ID) F24M12
Hit Gene Code At3g51260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 20S proteasome alpha subunit PAD1
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At5g61840

Sequence (A. th genome BLAST matches underlined)
>87-K013565-022-179-G11-8409
NTGATCCATGATGATCTTCCCGGACATGAAGCACTTTAAAAAGAAGACGGGATATCAACA
TGTCCGGTAATGGACCGAGGCGCAAGAATTGCTGCAATGGTGTTATATAAAAACTATGGG
ATGCTCCGTATAGAGATTCCTATGGGATCCTCCCTATAGTGAGTTTGNTCATAATAAAAA
ACATAAATGTCCTAAAACATATAATAAGTGCTTGATCGGTTTGGAATTTAGGACATAAAA
CTCAAAAAAGGAAAATTTATCAGACTGTTTTTAGAGCCATGGATTGTTCTTATAATCAGT
GATGATGTTTGTTTGTCAAACTGGCACAGGGGTGCAAGAGCAGCTGTATGGGAAAACTTC
AAAGACAATCCGCTGTTTGACATCTCAACAGAGCACCCAACAACATATTATGAGGACATG
CAGAGAGCAATCTTATGCCTATGCCCACTTGGATGGGCCCCATGGAGTCCAAGACTGGTG
GAAGCAGTGATATTCGGTTGCATCCCTGTGATCATAGCAGAAGACATCGTGTTACCTTTT
GCAGATGCAATCCCCTTGGGAAGATATTGGTGTGTTTGTGGATGAAAAAGATGTTCCTTA
CCTGGACAAATTATTACATTTATCCCACCAAGAGGTATATTGAAAAAACAGAGGTTGTTG
GCAAACCTGTTGATGAAAATAGGCCTTGCTGTTTCCGCAACCGGTTTAACCAGGGGATGC
GTTTCATTAAGTTTGGAAGGGGCTGGCTTAATAACTGGCTTAATAAAAGAAGGTTTTCCG
AAATACTGTGAAAAATTTTTTGACCTGGATGGTAGAACCGGCCCTCGCTTTTAAAATTGG
TACGGCCACGGCTTGAAATTCATATATAAACTATTGTTCCGCTGGCTCTTCCCCTCCGGG
GTGGTTTTTGAAAAAAATAAATTTCTCTTTTATGTAAAAAGGAAAAACTCTTTCCTTTTA
TTT
GenBank Accession AL771398 [GenBank]
Graphic View Graphic view of gene At5g61840
Predicted Position of Insertion Chr5:24840149 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MAC9
Hit Gene Code At5g61840 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Exostosin family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Brown et al. 2009, irx10-1]
Other FSTs Supporting this Hit BX530806 [GenBank]


Last Updated on 07.07.2016 14:03