Sequences from confirmation amplicon


Confirmation sequences for line 183C10 and hit At2g19480 are shown.
Line ID 183C10
Locus At2g19480 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:8439122
Primers used for PCR RE59 - 8474, show primer details
   
Sequence Name 13-K026864-022-183-C10C-8409
GenBank Accession LN491881 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>13-K026864-022-183-C10C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGGTAATTCACCTGAATCTCTCTTAGAA
ACTCGACACGCTTCCTGACTGGTGGAGTCAAGTTTTCAAGGACATCAGAGTGTTGTCCAG
CCAAATTCTGCAACTTGTTCTGCAGCAAACACGTAAATCAAATCAGGAAAAGTCACAAAC
TTTCAAACAACCAAATTAAGATGCATAGACAATCCTCAAAACCAAAGTCAAATTCTCTAA
GCCATAAGAATCAAATCAATTTCTCAAAACTAGTCAGGAAGAGAAAACAATCCCTAAAAG
TTACAAAGATGAATAGCCCAATCTCCAGATAGTCATACGCAAATCATATCGTGAAGAAAA
AACTCACCTTAAGAGCATTAACAAGCCCGGCACGATCCTCCTCGTTAAGAGCTATAAGCA
AAACACAAAACAAGAGAAGCTTTTTTCAATAAATCAAGAGAACAAAAGAGAA
   
Sequence Name 14-K026864-022-183-C10C-RE59
GenBank Accession LN492350 [GenBank]
Sequencing primer gene specific primer, RE59: 5'-GTTTCTTATCCTTCCTCTTCCTCC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K026864-022-183-C10C-RE59
GCCAGATTCTTTTCTTGCGAAGATGAGCAACGACAAGGACAGCATGAACATGTCCGATCT
CTCCACCGGTAAGATATTATAATCTTATTGTCCTATAGAATGAGGCCTGGATTCTCTTTT
GTTCTCTTGATTTATTGAAAAAAGCTTCTCTTGTTTTGTGTTTTGCTTATAGCTCTTAAC
GAGGAGGATCGTGCCGGGCTTGTTAATGCTCTTAAGGTGAGTTTTTTCTTCACGATATGA
TTTGCGTATGACTATCTGGAGATTGGGCTATTCATCTTTGTAACTTTTAGGGATTGTTTT
CTCTTCCTGACTAGTTTTGAGAAATTGATTTGATTCTTATGGCTTAGAGAATTTGACTTT
GGTTTTGAGGATTGTCTATGCATCTTAATTTGGTTGTTTGAAAGTTTGTGACTTTTCCTG
ATTTGATTTACGTGTTTGCTGCAGAACAAGTTGCAGAATTTGGCTGGACAACACTCTGAT
GTCCTTGAAAACTTGACTCCACCAGTCAGGAAGCGTGTCGAGTTTCTAAGAGAGATTCAG
GTGAATTACCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCACCAATGAGT
ATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCATTTTTTTTTCAATTCAAAAA

Last Updated on 07.07.2016 14:16